+++ /dev/null
-//
-// GCC-firm Project
-//
-// $Id$
-//
-// Testprogram to test GCC-firm : Args.c
-
-#include <stdio.h>
-
-static int id_0(int i, int j) {
- //int k;
- //k = 0;
- return(i);
-}
-
-int id_1(int i, int j) {
- //int k;
- //k = 0;
- return(j);
-}
-
-int main (int argc, char *argv[]) {
- //int k, i;
- printf("Args.c\n");
- printf("Result: %d (should be 2)\n", id_0(0,2) + id_1(0,2));
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-#include <string.h>
-
-struct Arr2Object {
- int a[10];
- int inrom[10];
- int b[10];
-} arr_init = {
- { 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 },
- { 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 2009 },
- { 1000, 1001 , 1002, 1003, 1004 , 1005, 1006, 1007, 1008, 1009}
-};
-
-struct ArrObject {
- int num;
-};
-
-void ctorArrObject(struct ArrObject *pThis, int i) {
- pThis->num = i;
-}
-
-void f(struct ArrObject *pThis) {
- printf("num is %d\n", pThis->num);
-}
-
-static void pass_array_test(struct ArrObject *a, int a_len)
-{
- int i;
-
- for(i = 0; i < a_len; i++) {
- f(&a[i]);
- }
-}
-
-#define length(a) (sizeof(a)/sizeof((a)[0]))
-
-int main(int argc, char *argv[]) {
- int i, j, bi;
- struct ArrObject ao[10];
- struct Arr2Object a2o[2];
- struct Arr2Object a2;
-
- for(i = 0; i < length(ao); i++)
- ctorArrObject(&ao[i], i);
-
- for(i = 0; i < 10; i++) {
- f(&ao[i]);
- }
-
- pass_array_test(ao, length(ao));
-
- for(i = 0; i < length(a2o); i++)
- memcpy(&a2o[i], &arr_init, sizeof(arr_init));
-
- for(i = 0; i < length(a2o[0].a); i++) {
- memcpy(&a2, &a2o[0], sizeof(a2));
- j = a2.a[i];
- printf("%d\n", j);
- }
-
- a2o[0].a[5] = 4711;
-
- printf("length(a2o[0].a) = %d\n", length(a2o[0].a));
- for(i = 0; i < length(a2o[0].a); i++) {
- printf("%d\n", a2o[0].a[i]);
- }
-
- printf("length(a2o[1].a) = %d\n", length(a2o[1].a));
- for(i = 0; i < length(a2o[1].a); i++) {
- printf("%d\n", a2o[1].a[i]);
- }
-
- printf("length(a2o[0].b) = %d\n", length(a2o[0].b));
- for(i = 0; i < length(a2o[0].b); i++) {
- memcpy(&a2, &a2o[0], sizeof(a2));
- bi = a2.b[i];
- printf("%d\n", bi);
- }
-
- printf("inrom 0 .. 9:\n");
- for(i = 0; i < 10; i++) {
- printf("%d\n", arr_init.inrom[i]);
- }
- return 0;
-}
+++ /dev/null
-/*
- * File name: test/BinaryOpTest.c
- * Purpose: test binary operators
- * Author: Boris Boesler
- * Modified by: Michael Beck
- * Created: X.Y.2003
- * CVS-ID: $Id$
- * Copyright: (c) 2003 Universitaet Karlsruhe
- * Licence:
- */
-
-#include <stdio.h>
-
-typedef int boolean;
-#define true 1
-#define false 0
-
-static int id(int i) {
- return(i);
-}
-
-static boolean bid(boolean i) {
- return(i);
-}
-
-static void nop(int i) {
- printf(" %d\n", i);
-}
-
-static void test_and_and(int i, int j) {
- if((i + 5 == 1) && (j + 4 == 3))
- nop(1);
- else
- nop(2);
-}
-
-static void test_or_or(int i, int j) {
- if((i + 5 == 1) || (i + 4 == 3))
- nop(1);
- else
- nop(2);
-}
-
-int main(int argc, char *argv[]) {
- int i, j;
- int res;
- boolean b;
-
- printf("BinaryOpTest.c\n");
-
- b = bid(true);
- if(!b)
- i = id(1);
- else
- i = id(3);
- j = id(2);
-
- nop(i << j);
- nop(i >> j);
- nop(i & j);
- nop(i | j);
- nop(i ^ j);
- nop(~i);
-
- nop(i % j);
- nop(i / j);
-
- test_and_and(i,j);
- test_or_or(i,j);
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-
-static void test_for_break(int *array, int size, int end) {
- int i;
-
- printf("for:");
- for(i = 0 ; i < size; i++) {
- if(end == i)
- break;
- printf("%d", array[i]);
- }
-}
-
-static void test_while_break(int *array, int size, int end) {
- int i;
-
- i = 0;
- printf("while:");
- while(i < size) {
- if(end == i)
- break;
- printf("%d", array[i]);
- ++i;
- }
-}
-
-static void test_do_break(int *array, int size, int end) {
- int i;
-
- i = 0;
- printf("do:");
- do {
- if(end == i)
- break;
- printf("%d", array[i]);
- ++i;
- } while(i < size);
-}
-
-int main(int argc, char *argv[]) {
- int i, j;
- int array[20];
-
- i = 0;
- while(i < 20) {
- array[i] = i;
- i++;
- }
-
- printf("must print for:0123456789\n");
- printf("must print while:01234567891011\n");
- printf("must print do:012345678910\n\n");
-
- test_for_break(array, 20, 10);
- printf("\n");
-
- test_while_break(array, 20, 12);
- printf("\n");
-
- test_do_break(array, 20, 11);
- printf("\n");
-
- return 0;
-}
+++ /dev/null
-char glob = -1;
-
-int main(void) {
- char x = 126;
- while (x > 0) {
- x++;
- printf("%d\n", x);
- if (x == -125) break;
- }
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-int atoi(const char *s);
-
-int main(int argc, char *argv[])
-{
- unsigned char a, b, c;
-
- printf("ByteTest.c\n");
-
- a = atoi("200");
- b = atoi("56");
-
- c = a+b;
- printf(" 200 + 56 = %d (expected 0)\n", c);
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-int int_func(void)
-{
- return 42;
-}
-
-float float_func(void)
-{
- return 13.5f;
-}
-
-double double_func(void)
-{
- return 13.5;
-}
-
-int main(int argc, char *argv[])
-{
- printf("calltest.c\n");
-
- printf(" Calling int function: %d\n", int_func());
- printf(" Calling float function: %f\n", float_func());
- printf(" Calling double function: %f\n", double_func());
-
- return 0;
-}
+++ /dev/null
-/*
- * File name: test/CondExpr.c
- * Purpose: test conditional expressions
- * Author: Boris Boesler
- * Modified by: Michael Beck
- * Created: XX.02.2003
- * CVS-ID: $Id$
- * Copyright: (c) 2003 Universitaet Karlsruhe
- * Licence:
- */
-
-#include <stdio.h>
-
-static int id(int i) {
- return(i);
-}
-
-static void nop(int i) {
- printf(" i = %d\n", i);
-}
-
-int main (int argc, char *argv[]) {
- int i, j, res;
-
- printf("CondExpr.c:\n");
- i = id(1);
- j = id(2);
-
- i = (i == j)? id(10) : id(0);
- nop(i);
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-#define SIZE 100
-
-static void test_do_continue(int *a, int size) {
- int i = -1;
-
- printf(" test_do_continue:\n");
- do {
- ++i;
- if(10 == i)
- continue; // dont print
- printf("%d\n", a[i]);
- }
- while(i < size);
-}
-
-static void test_for_continue(int *a, int size) {
- int i;
-
- printf(" test_for_continue:\n");
- for(i = 0; i <= size; i++) {
- if(11 == i)
- continue;
- printf("%d\n", a[i]);
- }
-}
-
-static void test_while_continue(int *a, int size) {
- int i;
-
- i = -1;
-
- printf(" test_while_continue:\n");
- while(i < size) {
- i++;
- if(12 == i)
- continue;
- printf("%d\n", a[i]);
- }
-}
-
-int main(int argc, char *argv[]) {
- int i, j;
- int array[SIZE];
-
- printf("ContinueTest.c:\n");
- i = 0;
- while(i < SIZE) {
- array[i] = i;
- i++;
- }
-
- test_do_continue(array, 20);
- printf("\n");
- test_for_continue(array, 20);
- printf("\n");
- test_while_continue(array, 20);
- printf("\n");
-
- return 0;
-}
+++ /dev/null
-//
-// GCC-firm Project
-//
-// $Id$
-//
-// Testprogram to test GCC-firm : Declatations
-
-
-#include <stdio.h>
-
-
-int i, j, x;
-
-int main (int argc, char *argv[]) {
- int k, l;
- int i;
-
- printf("DeclTest.c\n");
- return 0;
-}
+++ /dev/null
-#include <string.h>
-
-int x[(1024 / sizeof (int))];
-
-int main(int argc, char *argv[]) {
- int y[(1024 / sizeof (int))];
-
- memset(y, 20, sizeof(y));
- memset(x, 22, (1024 / sizeof (int)));
-
- printf("DivBug. ok!\n");
- printf("Result: %d (should be 336860180)", y[(1024 / sizeof (int))-1]+x[(1024 / sizeof (int))-1]);
-
- return 0;
-}
+++ /dev/null
-
-/* $Id$ */
-/* Program builds a simple tree and walks the tree.
- Tree nodes are separated: one part contains the tree information,
- the other contains the data of the node. */
-
-#include <stdlib.h>
-#include <stdio.h>
-
-#define NULL ((void *)0)
-
-typedef struct Node Node;
-
-typedef struct Data {
- const char *name;
- const char *addr;
- int account1;
- int account2;
- int account3;
- Node *found;
-} Data;
-
-struct Node {
- Data mydata;
- int mykey;
- Node *son1;
- Node *son2;
- Node *son3;
- Node *son4;
-};
-
-static int Node_count;
-
-static Node *new_node(int depth) {
- Node *res;
-
- res = (void *)malloc(sizeof(*res));
- res->mykey = Node_count++; /* @@@ Want Random number */
-
- if (depth > 1) {
- res->son1 = new_node(depth-1);
- res->son2 = new_node(depth-1);
- res->son3 = new_node(depth-1);
- res->son4 = new_node(depth-1);
- } else {
- res->son1 = NULL;
- res->son2 = NULL;
- res->son3 = NULL;
- res->son4 = NULL;
- }
- return res;
-}
-
-static int find_max(Node *n) {
- if (n->son1 == NULL) {
- return n->mykey;
- } else {
- int max = find_max(n->son1);
- int max2 = find_max(n->son2);
- if (max2 > max) max = max2;
- /*max2 = find_max(n->son3);
- if (max2 > max) max = max2;
- max2 = find_max(n->son4);
- if (max2 > max) max = max2;*/
- return max;
- }
-}
-
-
-
-static Node *root; /* root of the tree to search */
-
-static void alloc (int depth) {
- root = new_node(depth);
-}
-static void search (void) {
- printf(" Max = %d\n", find_max(root));
-}
-
-int main(int argc, char *argv[]) {
- int depth;
-
- printf("Do.c:\n");
- if (argc <= 1) {
- printf("Usage: Do n\nGive search tree depth!\n");
- printf("10 is a good value, 12 too much.\n");
- printf("Continuing with default value 9.\n");
- depth = 9;
- } else {
- depth = atoi(argv[1]);
- }
- alloc(depth);
- search();
-
- return 0;
-}
+++ /dev/null
-//
-// $Id$
-//
-
-#include <stdio.h>
-
-int f;
-
-int poops(int i) {
- f++;
- return(i);
-}
-
-int main (int argc, char *argv[]) {
- int i;
-
- printf("Doit.c\n");
-
- i = 0;
- do {
- // i = i + 1;
- } while(i++ < 10);
-
- return 0;
-}
+++ /dev/null
-/*
- * Project: GCC-firm
- * File name: test/Empty.c
- * Purpose: smallest possible C program
- * Author: Boris Boesler
- * Modified by: Michael Beck
- * Created: XX.08.2001
- * CVS-ID: $Id$
- * Copyright: (c) 2001 Universitaet Karlsruhe
- * Licence:
- */
-
-
-int main () {
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-
-void endless(void)
-{
- for (;;) {
- }
-}
-
-int main(int argc, char *argv[])
-{
- printf("EmptyFor.c:\n");
-
- return 0;
-}
+++ /dev/null
-/*
- * $Id$
- */
-
-#include <stdio.h>
-
-struct s {
- int a;
-};
-
-int m(struct s *pThis) {
- return(pThis->a);
-}
-
-int main(void) {
-
- printf("Field.c\n");
-
- return 0;
-}
+++ /dev/null
-/*
- * Project: GCC-fim
- * File name: test/Empty.c
- * Purpose: float test
- * Author: Boris Boesler
- * Modified by: Michael Beck (for GCC-firm)
- * Created: XX.08.2001
- * CVS-ID: $Id$
- * Copyright: (c) 2001 Universitaet Karlsruhe
- * Licence:
- */
-
-#include <stdio.h>
-#include <float.h>
-
-static void compute (double d1) {
- double d2, d3;
- d2 = 123456789.0;
- d3 = d1 + d2;
- printf(" expecting 123456789012345678.0: %19.1f\n", d3);
-}
-
-#define _p(x) #x
-#define p(x) _p(x)
-
-int main (int argc, char *argv[]) {
- float fminplus = +FLT_MIN;
- float fminminus = -FLT_MIN;
- float fmaxplus = FLT_MAX;
- float fmaxminus = -FLT_MAX;
- double dminplus = +DBL_MIN;
- double dminminus = -DBL_MIN;
- double dmaxplus = +DBL_MAX;
- double dmaxminus = -DBL_MAX;
-
- printf("\nExtreme representable float values:\n");
- printf(" +" p(FLT_MIN) " = %+1.8E\n", fminplus);
- printf(" -" p(FLT_MIN) " = %+1.8E\n", fminminus);
- printf(" +" p(FLT_MAX) " = %+1.8E\n", fmaxplus);
- printf(" -" p(FLT_MAX) " = %+1.8E\n", fmaxminus);
-
- printf("\nExtreme representable double values:\n");
- printf(" +" p(DBL_MIN) " = %+1.17E\n", dminplus);
- printf(" -" p(DBL_MIN) " = %+1.17E\n", dminminus);
- printf(" +" p(DBL_MAX) " = %+1.17E\n", dmaxplus);
- printf(" -" p(DBL_MAX) " = %+1.17E\n", dmaxminus);
-
- compute(1234567890000000000.0);
-
- return 0;
-}
+++ /dev/null
-//
-// GCC-firm Project
-//
-// $Id$
-//
-// Testprogram to test GCC-firm : For loop
-
-#include <stdio.h>
-
-typedef int boolean;
-
-#define true 1
-#define false 0
-
-static int simpleloop (int a, int b) {
- int i, j;
- boolean loopfinal = true;
-
- for(i = 0; (i < 10) && loopfinal; i++) {
- if(5 == i)
- loopfinal = false;
- printf("%d ", i);
- }
- printf("\n");
-
- for(i = 0; i < a; ++i) {
- for(j = 0; j < b; ++j) {
- printf("%d,%d\n", i, j);
- }
- }
- return(i);
-}
-
-int main (int argc, char *argv[]) {
- printf("ForTest.c\n");
-
- simpleloop(3, 10);
- return 0;
-}
+++ /dev/null
-//
-// GCC-firm Project
-//
-// $Id$
-//
-// Testprogram to test GCC-firm : GlobalCseTest.c
-#include <stdio.h>
-
-int m(int a) {
- int b;
- if ( a == 1) {
- /* Global cse should move the Subtraction before or after this if. */
- if( a == 0) b = a - 2; else b = a - 2;
- } else {
- b = 4;
- }
- return b;
-
-}
-
-int main (int argc, char *argv[]) {
- printf("GlobalCseTest.c\n");
-
- m(4);
-
- return 0;
-}
+++ /dev/null
-/*
- * Project: GCC-firm
- * File name: test/Hanoi.c
- * Purpose: Towers of hanoi
- * Author: Arne Frick (in Sather-k)
- * Modified by: Michael Beck (for C)
- * Created: XX.11.2001
- * CVS-ID: $Id$
- * Copyright: (c) 2001 Universitaet Karlsruhe
- * Licence:
- */
-
-#include <stdlib.h>
-#include <stdio.h>
-
-typedef int boolean;
-
-#define true 1
-#define false 0
-
-static int stick[3];
-static int moves;
-static boolean verbose = false;
-
-void init(int n) {
- //-- initializes an array of pegs
- stick[0] = n;
- stick[1] = 0;
- stick[2] = 0;
- moves = 0;
-}
-
-void hanoi(int n, int from, int to) {
- int spare = 3 - from - to;
- if(n > 0) {
- //-- moves the stack of pegs from stick[from] via stick[temp]
- //-- to stick[to]
-
- hanoi (n-1, from, spare);
- ++moves;
- stick[from] = stick[from] - 1;
- stick[to] = stick[to] + 1;
- if (verbose) {
- printf("move %d to %d\n", from, to);
- }
- hanoi (n-1, spare, to);
- }
-}
-
-//--~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
-
-int main(int argc, char *argv[]) {
- int i = 1;
- boolean n_specified = false;
-
- int n;
-
- /*
- if args.asize > i and args[i].equals ("-v") {
- verbose = true;
- i = i + 1;
- }
- */
- printf("Hanoi.c\n");
-
- if (argc <= 1) {
- /*
- if i /= args.asize - 1 {
- << " wrong # of arguments\n\n"
- "Usage: hanoi [-v] n\n"
- " where n is the number of pegs\n"
- " -v enables verbose printing of moves\n";
- */
- printf("Usage: hanoi n\nWhere n is the number of pegs.\nContinuing with default: n = 21 (-> 2097151)\n");
- n = 21;
- }
- else {
- n = atoi(argv[1]);
- }
-
- init (n);
- hanoi (n, 0, 2);
- //<< "Total #moves: " << p.moves << "\n";
- // hanoi(28) = 268435455
- printf(" number of moves : %d\n", moves);
-
- return 0;
-}
+++ /dev/null
-/*
- * Project: GCC-firm
- * File name: test/HeapSort.java
- * Purpose: sorting with heapsort
- * Author:
- * Modified by: Michael Beck (for GCC-firm)
- * Created: XX.11.2001
- * CVS-ID: $Id$
- * Copyright: (c) 2003 Universitaet Karlsruhe
- * Licence:
- * URL: http://www-info1.informatik.uni-wuerzburg.de/staff/wolf/teaching/pi1_ws98/java/Heapsort.java
- * Bugs: Fails for input 5,3,4,7,99
- */
-
-#include <stdlib.h>
-#include <stdio.h>
-
-/**
- * Heapsort-Algorithmus laut Vorlesung.
- */
-/** Größe des Heaps */
-static int N;
-
-/**
- * Tauscht die Elemente a[i] und a[j].
- */
-static void exchange(int *a, int i, int j) {
- int v;
- v = a[i];
- a[i] = a[j];
- a[j] = v;
-}
-
-/**
- * Läßt a[k] im Feld aufsteigen.
- */
-static void upheap(int *a, int k) {
- while ((k > 0) && (a[k] < a[k / 2])) {
- exchange(a, k, k / 2);
- k = k / 2;
- }
-}
-
-/**
- * Fügt das neue Element v in den Heap der Größe N
- * ein und erhöht N um 1
- */
-static void insert(int *a, int v) {
- a[N] = v;
- upheap(a, N);
- N++;
-}
-
-/**
-* Läßt a[k] im Feld versickern.
-*/
-static void downheap(int *a, int k) {
- int j = 2 * k;
- if (j < N) { // a[k] hat linken Sohn a[j]
- if (j + 1 < N) // a[k] hat auch rechten Sohn a[j+1]
- if (a[j] > a[j + 1])
- j++; // Jetzt ist a[j] der kleinere Sohn von a[k]
- if (a[k] > a[j]) {
- exchange(a, k, j);
- downheap(a, j);
- }
- }
-}
-
-/**
- * Liefert als Resultat das Heap-Element a[k], entfernt a[k]
- * aus dem Heap und stellt die Heap-Eigenschaft wieder her.
- */
-static int removeh(int *a, int k) {
- int v = a[k];
- a[k] = a[--N];
- if ((k > 0) && (a[k] < a[k / 2]))
- upheap(a, k);
- else
- downheap(a, k);
-
- return v;
-}
-
-/**
- * Aufbau des Heaps durch downheap.
- */
-static void heapaufbau1(int *a) {
- int k;
-
- for (k = N / 2; k >= 1; k--)
- downheap(a, k);
-}
-
-/**
- * Aufbau des Heaps durch insert.
- */
-static void heapaufbau2(int *a, int *b, int len) {
- int k;
- N = 0;
- for (k = 0; k < len; ++k)
- insert(a, b[k]);
-}
-
-/**
- * Sortiert das gegebene Feld b mit den oben angegebenen
- * Heap-Methoden und gibt das sortierte Feld zurück.
- */
-static int *heapsort_(int *b, int len) {
- int k;
- int *c;
- int *a;
-
- // Globale Variablen für die Heap-Methoden setzen
- a = malloc(sizeof(a[0]) * len);
- heapaufbau2(a, b, len);
-
- // Ergebnis in c kopieren
- c = malloc(sizeof(c[0]) * len);
- for (k = 0; k < len; k++)
- c[k] = removeh(a, 0);
-
- return c;
-}
-
-static int verify(int* fld, int count) {
- int i;
- int last = fld[0];
- for(i = 1; i < count; ++i) {
- if(fld[i] < last)
- return 0;
- last = fld[i];
- }
-
- return 1;
-}
-
-/**
- * Ein einfaches Beispielprogramm. Alle Argumente des Programms müssen
- * Zahlen sein.
- * Bsp:<pre>
- * java Heapsort 6 13 17 42 9 3 5
- * array={6,13,17,42,9,3,5}
- * sorted array={3,5,6,9,13,17,42}
- * </pre>
- */
-int main (int argc, char *argv[]) {
- // Umwandeln der Argumente in Zahlen
- int *b;
- int i, count, seed;
-
- printf("Heap.c\n");
-
- if(argc > 1)
- count = atoi(argv[1]);
- else
- count = 10000;
-
- if(argc > 2)
- seed = atoi(argv[2]);
- else
- seed = 123456;
-
- srand(seed);
-
- b = (void*) malloc(sizeof(b[0]) * count);
- for(i = 0; i < count; ++i)
- b[i] = rand();
-
- printf("Sorting %d random numbers (seed %d)\n",
- count, seed);
-
- // Sortieren
- b = heapsort_(b, count);
-
- printf("Sorted.\n");
-
- if(verify(b, count))
- printf("Verify succeeded.\n");
- else
- printf("Verify failed.\n");
-
- return 0;
-}
+++ /dev/null
-//
-// GCC-firm Project
-//
-// $Id$
-//
-// Testprogram to test GCC-firm : Hello World
-
-#include <stdio.h>
-
-
-int main (int argc, char *argv[]) {
- printf("HelloWorld.c\n");
- printf(" Hello World!\n");
- return 0;
-}
+++ /dev/null
-//
-// GCC-firm Project
-//
-// $Id$
-//
-// Testprogram to test GCC-firm : Declatations - part ][
-
-#include <stdio.h>
-
-static int test (int arg0) {
- int a, b, c;
- a = arg0;
- c = 2;
- b = 69;
- if((a) == c) {
- c = b - 1;
- }
- else {
- c = a + 77;
- }
- return(c);
-}
-
-static int const_if(int arg0) {
- int a;
- if(2 < 3) {
- a = 5;
- }
- else {
- a = 7;
- }
- return(a);
-}
-
-int main(int argc, char *argv[]) {
- printf("IfExpr.c\n");
-
- printf(" test(2) = %d (should be 68)\n", test(2));
- printf(" test(3) = %d (should be 80)\n", test(3));
- printf(" const_if(0) = %d (should be 5)\n", const_if(0));
-
- return 0;
-}
+++ /dev/null
-/*
- * Project: GCC-firm
- * File name: test/Int.c
- * Purpose: smallest possible Java program
- * Author: Boris Boesler
- * Modified by: Michael Beck
- * Created: XX.08.2001
- * CVS-ID: $Id$
- * Copyright: (c) 2001 Universitaet Karlsruhe
- * Licence:
- */
-
-#include <stdio.h>
-
-static int hide_int (int i) { /* to cancel out optimization */
- return i;
-}
-
-int main (int argc, char *argv[]) {
- int imax = 2147483647; /* java.lang.Integer.MAX_VALUE */
- int imin1 = -2147483647; /* java.lang.Integer.MIN_VALUE+1 */
- int imin = -2147483648; /* java.lang.Integer.MIN_VALUE */
- int i;
-
- printf("Int.c\n");
-
- printf(" Extreme constant integer values allowed in C:\n");
- printf(" Integer.MAX_VALUE ( 2147483647) = %d\n", imax);
- printf(" Integer.MIN_VALUE-1 (-2147483647) = %d\n", imin1);
- printf(" Integer.MIN_VALUE (-2147483648) = %d\n", imin);
-
- printf("\n Computations with integers:\n");
- i = 2147483647 - hide_int(147483647); /* to cancel out optimization */
- printf(" i = 2147483647 - 147483647 (2000000000): %d\n", i);
- i = i / 5;
- printf(" i = i / 5 (400000000): %d\n", i);
- i = i * -2;
- printf(" i = i * -2 (-800000000): %d\n", i);
- i = i + 12344321;
- printf(" i = i + 12344321 (-787655679): %d\n", i);
- i = i % 100000000;
- printf(" i = i %% 100000000 (-87655679): %d\n", i);
-
- printf("\n Computations exceeding the maximal values:\n");
- i = imax + 1;
- printf(" i = imax + 1 () : %d\n", i);
- i = imax * 2;
- printf(" i = imax * 2 () : %d\n", i);
- i = imax - 1;
- printf(" i = imin - 1 () : %d\n", i);
- i = imin * 2;
- printf(" i = imin * 2 () : %d\n", i);
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-static void for_test(void)
-{
- int i;
-
- for (i = 0; i < 10; ++i) {
- goto end;
- printf(" %d\n", i);
- }
-end:
- printf(" Leaving with i = %d\n", i);
- return;
-}
-
-int main(int argc, char *argv[])
-{
- printf("Label.c\n");
-
- goto weg;
- printf(" GOTO Failed\n");
- return 0;
-weg:
- printf(" GOTO Successful\n");
-
- for_test();
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-//
-// GCC-firm Project
-//
-// $Id$
-//
-// Testprogram to test GCC-firm : Local.c
-
- /*
-public long id_0(long i, int j, long k, long l) {
- return(i + 1);
-}
- */
-int id_1(int i, int j) {
- int k;
- int g;
- k = i + 1;
- g = j - 1;
- return((k * g) / 2);
-}
-
-int main (int argc, char *argv[]) {
- printf("Local.c\n");
- printf(" id_1(3,5) = %d\n", id_1(3,5));
- return 0;
-}
+++ /dev/null
-/*$ -std=c99 $*/
-/*
- * Project: GCC-firm
- * File name: test/Long.c
- * Purpose: Long integer test program
- * Author: Goetz Lindenmaier
- * Modified by: Michael Beck
- * Created: XX.04.2002
- * CVS-ID: $Id$
- * Copyright: (c) 2002 Universitaet Karlsruhe
- * Licence:
- */
-
-#include <stdio.h>
-
-static int hide_int (int i) {
- return i;
-}
-
-int main (int argc, char *argv[]) {
- long long lmax, lmin, lmin1, limax, limin1, limin, l1, l;
- int i;
-
- printf("LongLong.c\n");
-
- lmax = 9223372036854775807LL; /* java.lang.Long.MAX_VALUE */
- lmin1 = -9223372036854775807LL; /* java.lang.Long.MIN_VALUE */
- lmin = -9223372036854775808LL; /* java.lang.Long.MIN_VALUE */
- limax = 2147483647L; /* java.lang.Integer.MAX_VALUE */
- limin1 = -2147483647L; /* java.lang.Integer.MAX_VALUE-1 */
- limin = -2147483648L; /* java.lang.Integer.MIN_VALUE */
-
- printf(" Long long values allowed in C:\n");
- /* So far, these values are not representable by libfirm. */
- printf(" LongLong.MAX_VALUE ( 9223372036854775807LL) = %lld\n", lmax);
- printf(" LongLong.MIN_VALUE-1 (-9223372036854775807LL) = %lld\n", lmin1);
- printf(" LongLong.MIN_VALUE (-9223372036854775808LL) = %lld\n", lmin);
-
- printf("\n Extreme integer values represented as long long:\n");
- printf(" Long.MAX_VALUE ( 2147483647L) = %lld\n", limax);
- printf(" Long.MIN_VALUE-1 (-2147483647L) = %lld\n", limin1);
- printf(" Long.MIN_VALUE (-2147483648L) = %lld\n", limin);
-
- printf("\n Computations exceeding these barriers:\n");
- i = 2147483647;
- //i = 2;
- l = hide_int(i) + 3LL;
- printf(" long long l = (int i = 2147483647) + 3LL (2147483650): %lld\n", l);
- l = 2 * l;
- printf(" long long l = 2 * l (4294967300): %lld\n", l);
- l = l * -1;
- printf(" long long l = l * -1 (-4294967300): %lld\n", l);
- l = l / 3;
- printf(" long long l = l / 3 (-1431655766): %lld\n", l);
- l = l % 1000000000;
- printf(" long long l = l %% 1000000000 (-431655766): %lld\n", l);
-
- return 0;
-}
+++ /dev/null
-/* testing conversion */
-int test(unsigned long long x) {
- return x;
-}
-
-int main() {
- printf("%d\n", test(0x1234567812345678LL));
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-#include <stdlib.h>
-
-void merge (float *, int, int, int);
-
-/* sort the (sub)array v from start to end */
-
-void merge_sort (float *v, int start, int end) {
- int middle; /* the middle of the subarray */
-
- /* no elements to sort */
- if (start == end) return;
-
- /* one element; already sorted! */
- if (start == end - 1) return;
-
- /* find the middle of the array, splitting it into two subarrays */
- middle = (start + end) / 2;
-
- /* sort the subarray from start..middle */
- merge_sort (v, start, middle);
-
- /* sort the subarray from middle..end */
- merge_sort (v, middle, end);
-
- /* merge the two sorted halves */
- merge (v, start, middle, end);
-}
-
-/* merge the subarray v[start..middle] with v[middle..end], placing the
- * result back into v.
- */
-void merge (float *v, int start, int middle, int end) {
- int v1_n, v2_n, v1_index, v2_index, i;
-
- float *v1 = malloc((middle - start) * sizeof(*v1));
- float *v2 = malloc((end - middle) * sizeof(*v2));
-
- /* number of elements in first subarray */
- v1_n = middle - start;
-
- /* number of elements in second subarray */
- v2_n = end - middle;
-
- /* fill v1 and v2 with the elements of the first and second
- * subarrays, respectively
- */
- for (i=0; i<v1_n; i++) v1[i] = v[start + i];
- for (i=0; i<v2_n; i++) v2[i] = v[middle + i];
-
- /* v1_index and v2_index will index into v1 and v2, respectively... */
- v1_index = 0;
- v2_index = 0;
-
- /* ... as we pick elements from one or the other to place back
- * into v
- */
- for (i=0; (v1_index < v1_n) && (v2_index < v2_n); i++) {
-
- /* current v1 element less than current v2 element? */
- if (v1[v1_index] <= v2[v2_index])
-
- /* if so, this element belong as next in v */
- v[start + i] = v1[v1_index++];
- else
- /* otherwise, the element from v2 belongs there */
- v[start + i] = v2[v2_index++];
- }
- /* clean up; either v1 or v2 may have stuff left in it */
-
- for (; v1_index < v1_n; i++) v[start + i] = v1[v1_index++];
- for (; v2_index < v2_n; i++) v[start + i] = v2[v2_index++];
-
- free(v1); free(v2);
-}
-
-int main(int argc, char **argv) {
- float *f;
- int i, len;
-
- printf("MergeSort.c\n");
-
- len = argc - 1;
- f = malloc(len * sizeof(*f));
-
- for(i = 0; i < argc - 1; i++) {
- if (!sscanf(argv[i + 1], "%f", f + i)) { printf("Argument %d invalid, float expected instead of '%s'!\n", i, argv[i + 1]); return 1; }
- printf(" %f\n", f[i]);
- }
-
- if (len < 1) {
- printf("Usage: MergeSort <list of numbers>\n");
- printf("Continuing with default input.\n");
- f = (void *)malloc(sizeof(*f) * (len = 6));
- f[0] = 3.3; f[1] = 18.18; f[2] = 5.5; f[3] = 99.99; f[4] = 104.104; f[5] = 2.2;
- }
-
- // Ausgabe
- printf(" array = ");
- for(i = 0; i < len - 1; i++) {
- printf(" %f,", f[i]);
- }
- if (len > 0) {
- printf(" %f\n", f[len - 1]);
- }
- // Sortieren
- merge_sort(f, 0, len);
-
- // Ausgabe
- printf(" sorted array = ");
- for(i = 0; i < len - 1; i++) {
- printf(" %f,", f[i]);
- }
- if (len > 0) {
- printf(" %f\n", f[len - 1]);
- }
-
- return 0;
-}
+++ /dev/null
-
-#include <stdio.h>
-
-
-int main (void)
-{
-
- int i=0, j=0;
- i=(j<0 || i<0 || j<1);
- return 0;
-
-} /* main() */
+++ /dev/null
-/*
- --
- -- beispiel fuer register allokation ueber program dependence graph
- --
-*/
-
-#include <stdio.h>
-
-int main(int argc, char *argv[]) {
- int i, j, k;
-
- printf("Pdg.c\n");
-
- i = 1;
- k = 0;
- while (i < 10) {
- j = i + 1;
- if (j == 7)
- k = 0;
- else
- k = 1;
- i = i + 1;
- }
-
- (void) k;
- return 0;
-}
+++ /dev/null
-/*
- * Project: GCC-firm
- * File name: test/Queens.c
- * Purpose: solve the queens problem
- * Author: Markus Armbruster (in sather-k)
- * Modified by: Michael Beck (for GCC-firm)
- * Created: XX.11.2001
- * CVS-ID: $Id$
- * Copyright: (c) 2001 Universitaet Karlsruhe
- * Licence:
- */
-/*
- -- The notorious n-queens problem (C.F. Gauss, 1850)
- -- Copyright (C) 1996 Markus Armbruster
-*/
-
-#include <stdlib.h>
-#include <stdio.h>
-
-
-typedef int boolean;
-
-#define true 1
-#define false 0
-
-static int *row;
-// queen in column c is at row[c]
-
-static int myabs(int i) {
- if(0 > i)
- i = -i;
- return(i);
-}
-
-static boolean place_ok (int i) {
- // return whether queen in column i is
- // not in check from queens left of it
- int j = 0;
- boolean res;
-
- while (j < i) {
- if ((row[j] == row[i]) || ((myabs(row[i]-row[j])) == (i-j))) {
- res = false;
- return(res);
- }
- j = j+1;
- }
- res = true;
- return(res);
-}
-
-static int solve (int n) {
- // return the number of solutions to the n-queens problem
- int c = 0;
- int res = 0;
-
- row = (void *)malloc(sizeof(*row) * n);
- row[0] = -1;
- while (c >= 0) {
- row[c] = row[c]+1;
- while ((row[c] < n) && (!place_ok(c))) {
- row[c] = row[c]+1;
- }
- if (row[c] < n) { // successfully placed at (c,row[c])
- if (c == n-1)
- res = res+1;
- else {
- c = c+1;
- row[c] = -1;
- }
- }
- else // dead end, track back
- c = c-1;
- }
- free(row);
-
- return(res);
-}
-
-static void usage (const char *progname) {
- printf("usage: %s [n]\n", progname);
-}
-
-
-int main (int argc, char *argv[]) {
- int n;
-
- switch (argc) {
- case 1:
- n = 8;
- break;
- case 2:
- n = atoi(argv[1]);
- break;
- default:
- usage("queens");
- return 0;
- }
- printf("The %d-queens problem has %d solutions.\n", n, solve(n));
-
- return 0;
-}
+++ /dev/null
-/*
- * Project: GCC-firm
- * File name: test/Quicksort.c
- * Purpose: sorting with quicksort
- * Author:
- * Modified by: Michael Beck (for GCC-firm)
- * Created: XX.11.2001
- * CVS-ID: $Id$
- * Copyright: (c) 2001 Universitaet Karlsruhe
- * Licence:
- * URL: http://www-info1.informatik.uni-wuerzburg.de/staff/wolf/teaching/pi1_ws98/java/QuickSort.java
- */
-#include <stdio.h>
-#include <stdlib.h>
-
-//#define COUNTACTIONS
-
-#ifdef COUNTACTIONS
-// Variablen, in denen die Bewegungen und Vergleiche gespeichert werden
-static int bewegungen = 0;
-static int vergleiche = 0;
-#endif
-
-
-//--------------------
-// quicksort-Funktion
-//--------------------
-static void quicksort(int *fld, int l, int r ) {
- // Wenn der zu sortierende Teil eine Laenge <= 1 hat -> fertig
- if( l >= r )
- return;
-
- int pivot = fld[r];
- int i = l-1, j = r;
- int v;
-
- // mit dem Pivotelement sortieren
- while( 1 ) {
- while( fld[++i] < pivot ) {
-#ifdef COUNTACTIONS
- vergleiche++;
-#endif
- }
-#ifdef COUNTACTIONS
- vergleiche++;
-#endif
-
- while( j > l && fld[--j] > pivot ) {
-#ifdef COUNTACTIONS
- vergleiche++;
-#endif
- }
-
-#ifdef COUNTACTIONS
- vergleiche++;
-#endif
- // Wenn j <= i ist, wurde der zu sortierende Teil des Feldes
- // durchlaufen -> fertig
- if( j <= i )
- break;
-
- // Elemente tauschen
- v = fld[i];
- fld[i] = fld[j];
- fld[j] = v;
- // ein Tausch zweier Feldelemente wird als eine Bewegung gerechnet
-#ifdef COUNTACTIONS
- bewegungen++;
-#endif
- }
-
- // Pivotelement in die Mitte tauschen
- fld[r] = fld[i];
- fld[i] = pivot;
-
-#ifdef COUNTACTIONS
- bewegungen++;
-#endif
-
- // Die zwei Teilfolgen rekursiv mit quicksort sortieren
- quicksort( fld, l, i-1 );
- quicksort( fld, i+1, r );
-}
-
-static int verify(int* fld, int count) {
- int i;
- int last = fld[0];
- for(i = 1; i < count; ++i) {
- if(fld[i] < last)
- return 0;
- last = fld[i];
- }
-
- return 1;
-}
-
-//------------------------------
-// Hauptfunktion des Programmes
-//------------------------------
-int main(int argc, char *argv[]) {
- int i, *fld;
- int count, seed;
-
- printf("QuickSort.c\n");
-
- if(argc > 1)
- count = atoi(argv[1]);
- else
- count = 10000;
-
- if(argc > 2)
- seed = atoi(argv[2]);
- else
- seed = 123456;
-
- srand(seed);
-
- fld = (void*) malloc(sizeof(*fld) * count);
- for(i = 0; i < count; ++i)
- fld[i] = rand();
-
- printf("Sorting %d random numbers (seed %d)\n",
- count, seed);
- // Sortieren
- quicksort(fld, 0, count-1);
-
- // Ausgabe
-#ifdef COUNTACTIONS
- printf("Sorted. (needed %d comparisons and %d moves.\n", vergleiche, bewegungen);
-#else
- printf("Sorted.\n");
-#endif
-
- if(verify(fld, count))
- printf("Verify succeeded.\n");
- else
- printf("Verify failed.\n");
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-#include <string.h>
-
-struct Arr2Object {
- int a[10];
- int inrom[10];
- int b[10];
-} arr_init = {
- { 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 },
- { 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 2009 },
- { 1000, 1001 , 1002, 1003, 1004 , 1005, 1006, 1007, 1008, 1009}
-};
-
-struct ArrObject {
- int num;
-};
-
-void ctorArrObject(struct ArrObject *pThis, int i) {
- pThis->num = i;
-}
-
-void f(struct ArrObject *pThis) {
- printf("num is %d\n", pThis->num);
-}
-
-static void pass_array_test(struct ArrObject *a, int a_len)
-{
- int i;
-
- for(i = 0; i < a_len; i++) {
- f(&a[i]);
- }
-}
-
-#define length(a) (sizeof(a)/sizeof((a)[0]))
-
-int main(int argc, char *argv[]) {
- int i, j, bi;
- struct ArrObject ao[10];
- struct Arr2Object a2o[2];
- struct Arr2Object a2;
-
- (void) argc;
- (void) argv;
- for(i = 0; i < length(ao); i++)
- ctorArrObject(&ao[i], i);
-
- for(i = 0; i < 10; i++) {
- f(&ao[i]);
- }
-
- pass_array_test(ao, length(ao));
-
- for(i = 0; i < length(a2o); i++)
- memcpy(&a2o[i], &arr_init, sizeof(arr_init));
-
- for(i = 0; i < length(a2o[0].a); i++) {
- memcpy(&a2, &a2o[0], sizeof(a2));
- j = a2.a[i];
- printf("%d\n", j);
- }
-
- a2o[0].a[5] = 4711;
-
- for(i = 0; i < length(a2o[0].a); i++) {
- printf("%d\n", a2o[0].a[i]);
- }
- for(i = 0; i < length(a2o[1].a); i++) {
- printf("%d\n", a2o[1].a[i]);
- }
-
- for(i = 0; i < length(a2o[0].b); i++) {
- memcpy(&a2, &a2o[0], sizeof(a2));
- bi = a2.b[i];
- printf("%d\n", bi);
- }
-
- for(i = 0; i < 10; i++) {
- printf("%d\n", arr_init.inrom[i]);
- }
- return 0;
-}
+++ /dev/null
-//
-// GCC-firm Project
-//
-// $Id$
-//
-// Testprogram to test GCC-firm : Return
-
-#include <stdio.h>
-
-int main (int argc, char *argv[]) {
- printf("Return.c\n");
- return(0);
-}
+++ /dev/null
-/*
- * Project: GCC-firm
- * File name: test/Sieve.c
- * Purpose: Eratosthenes Sieve prime number benchmark in Java
- * Author: Boris Boesler
- * Modified by: Michael Beck (for GCC-firm)
- * Created: XX.08.2001
- * CVS-ID: $Id$
- * Copyright: (c) 2001 Universitaet Karlsruhe
- * Licence:
- */
-
-#include <stdlib.h>
-#include <stdio.h>
-
-typedef char boolean;
-
-#define true 1
-#define false 0
-
-static int SIZE = 500; //8190;
-/* Gl: 8190 takes too long for continuous testing. */
-
-static void mark_count(int c) {
- printf("number of primes in [2..%d) : %d (correct: 2..500: 95)\n", SIZE, c);
-}
-
-static void runSieve(void) {
- int ITERATIONS = 100000;
- boolean *flags;
- int i, prime, k;
- int iterations = 0;
- int count;
- int s = SIZE;
-
- flags = (void *)malloc(sizeof(*flags) * s);
-
- // loop around for measurements
- while(ITERATIONS > iterations) {
-#if 0
- for(i = 0; i < SIZE; i++)
- flags[i] = true;
-#endif
- memset(flags, 0x01010101, s);
- for(i = 2; i < s; i++) {
- if(flags[i]) {
- prime = i;
- for(k = i + prime; k < s; k += prime)
- flags[k] = false;
- }
- }
- iterations++;
- }
- // test correctness
- count = 0;
- for(i = 2; i < s; i++) {
- if(true == flags[i]) {
- count++;
- }
- }
- mark_count(count);
-}
-
-int main(int argc, char *argv[]) {
- printf("Sieve.c\n");
-
- if (argc <= 1) {
- printf("\nUsage: Sieve n\n");
- printf("Continuing with default input.\n");
- } else {
- SIZE = atoi(argv[1]);
- }
-
- runSieve();
-
- return 0;
-}
+++ /dev/null
-//
-// GCC-firm Project
-//
-// $Id$
-//
-
-#include <stdlib.h>
-#include <stdio.h>
-#include <time.h>
-
-typedef int boolean;
-
-typedef struct BitSet
-{
- int *P;
- int K;
-} BitSet;
-
-static void ctorBitSet(BitSet *pThis, int k)
-{
- pThis->P = (void *)malloc(sizeof(*(pThis->P)) * (k / 32 + 1));
- pThis->K = k;
-}
-
-static void set (BitSet *pThis, int i)
-{
- if (i < 0)
- return;
- pThis->P[i >> 5] |= (1 << (i & 0x0000001F));
-}
-static void clear (BitSet *pThis, int i)
-{
- pThis->P[i >> 5] &= ~(1 << (i & 0x0000001F));
-}
-
-static boolean get (BitSet *pThis, int i)
-{
- return (pThis->P[i >> 5] & (1 << (i & 0x0000001F))) != 0;
-}
-
-static int size (BitSet *pThis)
-{
- return pThis->K;
-}
-
-
-/* Sieve.c
-Das Primzahlsieb fuer C.
-*/
-
-static BitSet prime;
-// Enthaelt Flags fuer die ungeraden Zahlen:
-// 3,5,7,...
-// D.h., 2*i+3 ist prim, wenn prime[i] war ist
-
-static void sieve (void) {
-// das Sieb
- int k = size(&prime), i, j, p, l;
- // Zuerst alle Zahlen auf prim setzen
- for (i = 0; i < k; i++)
- set(&prime, i);
- // Dann Vielfache von Primzahlen aussieben
- for (i = 0; i < k; i++) {
- if (get(&prime, i)) {
- // 2*i+3 ist prim
- p = 2 * i + 3;
- l = (p * p - 3) / 2;
- if (l > k)
- break;
- for (j = l; j < k; j += p)
- clear(&prime, j); // streicht p*p,p*(p+2), etc.
- }
- }
-}
-
-int main (int argc, char *argv[]) {
- // Hauptprogramm
- int n, i, k, count;
-
- if (argc <= 1)
- n = 10000000;
- // falls keine Argumente in der Kommandozeile
- else
- n = atoi(argv[1]);
- // lies Anzahl aus der Kommandozeile
- k = (n - 3) / 2;
- printf("Counting primes up to %d.\n", (2 * k + 3));
-
- ctorBitSet(&prime, k);
- sieve(); // das Sieb
-
- // Zaehle gefundene Primzahlen:
- count = 1;
- for (i = 0; i < k; i++)
- if (get(&prime, i))
- count++;
- // Ausgabe:
- printf("%d primes found.\n", count);
-
- // list(); // nur fuer Testzwecke
- return 0;
-}
+++ /dev/null
-//
-// GCC-firm Project
-//
-// $Id$
-//
-// Testprogram to test GCC-firm : Declatations
-
-
-int main (int argc, char *argv[]) {
- int i = 0;
- i = 1;
- i = 2;
-
- return 0;
-}
+++ /dev/null
-/*
- * Project: GCC-firm
- * File name: test/Strings.c
- * Purpose: test some String stuff
- * Author: Boris Boesler
- * Modified by: Michael Beck
- * Created: 03.03.2003
- * CVS-ID: $Id$
- * Copyright: (c) 2003 Universitaet Karlsruhe
- * Licence:
- */
-
-#include <stdio.h>
-#include <stdlib.h>
-
-static void print_char(char c) {
- printf(" %c\n", c);
-}
-
-static void print_int(int i) {
- printf(" %d\n", i);
-}
-
-static void print_String(const char *s) {
- printf(" %s\n", s);
-}
-
-int main(int argc, char *argv[]) {
- int i;
- char *s = "test";
-
- printf("Strings.c\n");
- for(i = 1; i < argc; i++) {
- print_String(argv[i]);
- }
- print_String(s);
- print_char('\101');
- print_char('\x41');
- print_int(atoi("0"));
- print_int(atoi("1"));
- print_int(atoi("-4711"));
- print_int(atoi("0815"));
- print_int(atoi("+1001"));
- print_int(atoi("42"));
- print_int(atoi("000"));
-
- return 0;
-}
+++ /dev/null
-/*
- * File name: test/Swap.c
- * Purpose: test swap of to variables in a loop
- * Author: Boris Boesler
- * Modified by: Michael Beck
- * Created: XX.02.2003
- * CVS-ID: $Id$
- * Copyright: (c) 2003 Universitaet Karlsruhe
- * Licence:
- */
-
-#include <stdio.h>
-
-static void nop2(int i, int j) {
- printf("i = %d\n", i);
- printf("j = %d\n", j);
-}
-
-int main (int argc, char *argv[]) {
- int i, j, t, k;
-
- i = 1; j = 10; k = 3;
-
- while(0 < k) {
- nop2(i, j);
-
- t = i;
- i = j;
- j = t;
-
- //nop2(i, j);
- --k;
- }
-
- return 0;
-}
+++ /dev/null
-/*
- * File name: test/Switcher.c
- * Purpose: test the switch statement
- * Author: Boris Boesler
- * Modified by: Michael Beck
- * Created: XX.02.2003
- * CVS-ID: $Id$
- * Copyright: (c) 2003 Universitaet Karlsruhe
- * Licence:
- */
-
-#include <stdio.h>
-
-static void print_int(int i) {
- printf(" %d\n", i);
-}
-
-// standard switch with 1 case
-static void switch1(int i) {
- switch(i) {
- case 0:
- print_int(0);
- break;
- default:
- print_int(-1);
- //break;
- }
-}
-
-// standard switch with more than 1 case
-static void switch2(int i) {
- switch(i) {
- case 0:
- print_int(0);
- break;
- case 2:
- print_int(2);
- break;
- default:
- print_int(-1);
- break;
- }
-}
-
-// standard switch with fall through
-static void switch3(int i) {
- switch(i) {
- case 0:
- print_int(0);
- // fall through
- case 3:
- print_int(3);
- break;
- default:
- print_int(-1);
- break;
- }
-}
-
-// standard switch without default
-static void switch4(int i) {
- switch(i) {
- case 0:
- print_int(0);
- break;
- case 4:
- print_int(4);
- break;
- }
-}
-
-// standard switch without case
-static void switch5(int i) {
- switch(i) {
- default:
- print_int(-1);
- break;
- }
-}
-
-// standard switch with more than 1 case and controlflow change
-static void switch6(int i) {
- switch(i) {
- case 0:
- print_int(0);
- break;
- case 2:
- if(i < 6)
- print_int(2);
- else
- print_int(-2);
- break;
- default:
- print_int(-1);
- break;
- }
-}
-
-// standard switch with more than 1 case label
-static void switch7(int i) {
- switch(i) {
- case 0:
- print_int(0);
- break;
- case 2:
- case 3:
- print_int(5);
- break;
- default:
- print_int(-1);
- break;
- }
-}
-
-
-static void double_switch(int i) {
-
- switch(i) {
- case 16:
- printf(" is 16\n");
- switch(i % 4) {
- case 0:
- printf(" multiple of 4\n");
- break;
- default:
- printf(" not multiple of 4\n");
- break;
- }
- break;
-
- default:
- printf(" != 10 und != 16\n");
- break;
- }
-
-}
-
-int main (int argc, char *argv[]) {
- printf("Switcher.c\n");
- printf(" must print:\n 0\n 2\n 0\n 3\n -1\n 2\n 5\n is 16\n multiple of 4\n\n");
- switch1(0);
- switch2(2);
- switch3(0);
- switch4(5);
- switch5(0);
- switch6(2);
- switch7(3);
-
- double_switch(16);
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-void processOutputs() {
- switch(1) {
- case 0:
- if( 1 ) {
- printf("1\n");
- }
- else {
- printf("0\n");
- }
- }
-}
-
-int main(int argc, char *argv[]) {
- printf("Test.c\n");
-
- processOutputs();
-
- printf(" Ok\n");
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-#include <stdlib.h>
-
-
-static int id(int i) {
- return(i);
-}
-
-int main(int argc, char*argv[]) {
- int i, s;
- int count;
- int size;
-
- printf("Thilo.c\n");
-
- s = 0;
- if(argc > 1)
- size = atoi(argv[1]);
- else
- size = 1000;
- for(count = 0; count < 10000; count++) {
- s = 0;
- for(i = 1; i <= size; i++) {
- s += id(i);
- }
- }
- printf(" %d\n", s);
-
- return 0;
-}
+++ /dev/null
-//
-// $Id$
-//
-// Testprogram to test gcc-firm : While loop
-
-#include <stdio.h>
-
-static int test (int i) {
- int j;
- j = 0;
- while(i > 0) {
- i = i - 1;
- if(i == 3)
- break;
- }
- printf(" 3 == %d\n", i);
- return(j);
-}
-
-static int gcd (int a, int b) {
- int i = 0;
-
- while((a != b) && (i >= 0)){
- if(a > b) {
- a = a - b;
- }
- else {
- b = b - a;
- }
- ++i;
- }
- return(a);
-}
-
-int main (int argc, char *argv[]) {
- printf("While.c\n");
- printf(" 5 == %d\n", gcd(20, 15));
- test(10);
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-#include <stdlib.h>
-
-
-#define true 1
-
-static int loop = 2;
-static int quiet = 1;
-
-static void nop(void) {}
-
-static int me1(int num) {
- int i = 0;
-
- if (num == 1) {
- printf("Going into endless loop 1 \n .... \n ");
- while(7 > 2) {
- if(!quiet)
- printf("%d\n", i++);
- }
- } else {
- num ++;
- }
- return num;
-}
-
-static void me2(int num) {
- int i = 0;
-
- if (num != 2) {
- nop();
- } else {
- printf("Going into endless loop 2 \n .... \n ");
- while(true) {
- if(!quiet)
- printf("%d\n", i++);
- }
- }
-}
-
-static void me3(int num) {
- int i = 0;
-
- printf("Going into endless loop 3 \n .... \n ");
- while(true) {
- if(!quiet)
- printf("%d\n", i++);
- }
-}
-
-int main(int argc, char *argv[]) {
- printf("XXEndless.c\n");
- if (argc != 2) {
- printf("\nUsage: Endless n, where n determines the loop.\n");
- printf("Continuing with default input.\n");
- return 0;
- } else {
- loop = atoi(argv[1]);
- quiet = 0;
- }
- me1(loop);
- me2(loop);
- me3(loop);
-}
+++ /dev/null
-This directory contains some testapps found in the ack compiler:
- http://www.cs.vu.nl/ack/
+++ /dev/null
-/*
- * (c) copyright 1987 by the Vrije Universiteit, Amsterdam, The Netherlands.
- * See the copyright notice in the ACK home directory, in the file "Copyright".
- *
- */
-
-/* Author: E.G. Keizer */
-
-char rcs_id[] = "$Id$" ;
-
-main() {
- t1() ;
- t2() ;
- return 0 ;
-}
-
-t1() {
- char c ; int i ; long l ; unsigned u ;
-#ifndef NOFLOAT
- float f ;
-#endif
-
- /* test conversions */
-
- /* first some conversions on constants */
-
- printf("(int) '\\377' = %d\n",(int) '\377') ;
- printf("(long) -1 = %ld\n",(long) -1 ) ;
-#ifndef NOFLOAT
- printf("(float) 12 = %f\n",(float) 12 ) ;
- printf("(int) 3.14 = %d\n",(int) 3.14 ) ;
-#endif
- printf("(int) 32767L = %d\n",(int) 32767L ) ;
- printf("(int) -32768L = %d\n",(int) -32768L ) ;
- printf("(char) 128L = %d\n",(char) 128L) ;
- printf("(char) 0377 = %d\n",(char) 0377 ) ;
- printf("(char) -1 = %d\n",(char) -1 ) ;
- printf("(char) 10000 = %d\n",(char) 10000 ) ;
-
- /* conversions from characters */
- printf("From character\n") ;
- c = 127 ;
- i=c ;
- l=c ;
- u=c ;
-#ifndef NOFLOAT
- f=c ;
-#endif
- printf("\tchar %5d, int %6d, unsigned %6o, long %11ld\n",c,i,u,l) ;
-#ifndef NOFLOAT
- printf("\t\t\t\t\tfloat %f\n",f) ;
-#endif
- c = -1 ;
- i=c ;
- l=c ;
- u=c ;
-#ifndef NOFLOAT
- f=c ;
-#endif
- printf("\tchar %5d, int %6d, unsigned %6o, long %11ld\n",c,i,u,l) ;
-#ifndef NOFLOAT
- printf("\t\t\t\t\tfloat %f\n",f) ;
-#endif
- c = 0377 ;
- i=c ;
- l=c ;
- u=c ;
-#ifndef NOFLOAT
- f=c ;
-#endif
- printf("\tchar %5d, int %6d, unsigned %6o, long %11ld\n",c,i,u,l) ;
-#ifndef NOFLOAT
- printf("\t\t\t\t\tfloat %f\n",f) ;
-#endif
-
- /* from integer */
- printf("From integer\n") ;
- i= -64 ;
- c=i ;
- l=i ;
- u=i ;
-#ifndef NOFLOAT
- f=i ;
-#endif
- printf("\tchar %5d, int %6d, unsigned %6o, long %11ld\n",c,i,u,l) ;
-#ifndef NOFLOAT
- printf("\t\t\t\t\tfloat %f\n",f) ;
-#endif
- /* from long */
- printf("From long\n") ;
- l = -3 ;
- c = l ;
- i = l ;
- u = l ;
-#ifndef NOFLOAT
- f = l ;
-#endif
- printf("\tchar %5d, int %6d, unsigned %6o, long %11ld\n",c,i,u,l) ;
-#ifndef NOFLOAT
- printf("\t\t\t\t\tfloat %f\n",f) ;
-#endif
-
- printf("Casts from long\n");
- l = 75000;
- printf("\tchar %5d, int %d, unsigned short %6o, long %11ld\n",
- (char) l,(int) l,(unsigned short)l ,l) ;
-
-#ifndef NOFLOAT
- printf("From float\n") ;
- f = 121.5 ;
- c = f ;
- i = f ;
- u = f ;
- l = f ;
- printf("\tchar %5d, int %6d, unsigned %6o, long %11ld, float %f\n",c,i,u,l,f) ;
- f = 1e-4 ;
- c = f ;
- i = f ;
- u = f ;
- l = f ;
- printf("\tchar %5d, int %6d, unsigned %6o, long %11ld, float %f\n",c,i,u,l,f) ;
- f = 3276.6e1 ;
- i = f ;
- u = f ;
- l = f ;
- printf("\tint %6d, unsigned %6o, long %11ld, float %f\n",i,u,l,f) ;
- f = 1223432e3 ;
- l = f ;
- printf("\tlong %11ld, float %f\n",l,f) ;
-#endif
-
- /* some special cases */
- {
- int a[4] ;
-
- l = 3 ; a[3]= -17 ;
- printf("a[l] (l==%ld) %d\n",l,a[l]) ;
- printf("a[3l] %d\n",a[3l] ) ;
-
- }
- return 0 ;
-}
-
-t2()
-{
- long l1 = 0x1f010L;
- long l2;
-
- l2 = (unsigned short) l1;
- printf("(unsigned short) 0x1f010L = 0x%lx\n", l2);
- l2 = (short) l1;
- printf("(short) 0x1f010L = 0x%lx\n", l2);
-}
+++ /dev/null
-/*
- * (c) copyright 1987 by the Vrije Universiteit, Amsterdam, The Netherlands.
- * See the copyright notice in the ACK home directory, in the file "Copyright".
- *
- */
-
-/* Author: E.G. Keizer */
-
-char rcs_id[] = "$Id$" ;
-
-/* Test a few declaration features */
-/* Such as:
- forward function declarations,
- redeclarations,
- pointer to function declarations.
-*/
-
-static int sqr() ; /* forward declarations */
-extern int sqrt();
-
-main() {
- fdcl() ;
- hidden() ;
- return 0 ;
-}
-
-fdcl() {
- int (*a[2])() ;
-
- printf("sqr(4) %d\n",sqr(4)) ;
-
- a[0]=sqr ; a[1]=sqrt ;
- printf("(*a[0])(16) %d\n",(*a[0])(16) ) ;
- printf("(*a[1])( (*a[0])(3) ) %d\n", (*a[1])( (*a[0])(3) ) ) ;
-}
-
-static int sqr(par) int par ; {
- return par*par ;
-}
-
-int sqrt(par) int par ; {
- int x1,x2 ;
- int i ;
-
- if ( par<0 ) return -1 ;
- x1 = par ;
- i=0 ;
- do {
- x2 = x1 ;
- x1 = ( x2*x2 + par ) / (2*x2) ;
- if ( i++>=100 ) return -2 ;
- } while ( ( x2<x1 ? x1-x2 : x2-x1 ) > 0 ) ;
- return (x1+x2)/2 ;
-}
-
-int a = -8 ;
-
-hidden() {
- hide() ;
- printf("a outside hide %d\n",a) ;
-}
-
-int hide() {
- int a ;
-
- a = 4 ;
- printf("a in hide %d\n",a) ;
- {
- int a ;
-
- a = 16 ;
- printf("a in in hide %d\n",a) ;
-
- }
- printf("a in hide %d\n",a) ;
-}
+++ /dev/null
-/*
- * (c) copyright 1987 by the Vrije Universiteit, Amsterdam, The Netherlands.
- * See the copyright notice in the ACK home directory, in the file "Copyright".
- *
- */
-
-/* Author: E.G. Keizer */
-
-char rcs_id[] = "$Id$" ;
-
-/* Test initialisation of a V7 C-compiler */
-/* 1 sept 1980 */
-#include "local.h"
-
-/* Integers and constant expressions */
-
-int in1 = 4 ;
-int in2 = MAXINT ;
-int in3 = MININT ;
-int in4 ;
-int inzero ;
-
-int ice1 = (1-2+3*4/2)%3 ;
-int ice2 = ((((1&3)|4)^014) >> 1) <<1 ;
-int ice3 = ( (1==2) & (3<4) ) | (4>3) | (0<=0) | -2>=17 ;
-int ice4 = (~-1) ;
-int ice5 = (1==1 ? 3+4 : 5+6 ) ;
-int ice6 = (1!=1 ? 7+8 : 9+10 ) ;
-int ina[] = { 1, 3, 5 } ;
-
-pint() {
- static int sint = -1 ;
- int lint = in1+in3+sint ;
-
- printf("Integers:\n\n") ;
- printf("in1\t%d\nin2\t%d\nin3\t%d\nin4\t%d\ninzero\t%d\n\n",
- in1,in2,in3,in4,inzero ) ;
- printf("ice1\t%d\nice2\t%d\nice3\t%d\nice4\t%d\nice5\t%d\nice6\t%d\n\n",
- ice1,ice2,ice3,ice4,ice5,ice6 ) ;
- printf("ina\t%d,%d,%d\n\n",ina[0],ina[1],ina[2]) ;
- printf("sint\t%d\nlint\t%d\n\n",sint,lint) ;
-}
-
-/* Characters */
-
-char ch1 = 'a' ;
-char ch2 ;
-char cha1[] = "Mesg" ;
-char cha2[] = "" ;
-char cha3[] = "1" ;
-char cha4[] = "12" ;
-char cha5[] = "0123456789112345678921234567893123456789412345678951234567896123456789712345678981234567899123456789" ;
-
-char cha6[2][3] = {
- { 1, 2, 3 },
- { 4, 5, 6 }
-};
-char *pch1 = cha2 ;
-char *pch2 = "pch2" ;
-char *pch3 = "ppch3" ;
-char *pch4 = 0 ;
-
-pch() {
- static char stc[] = "123" ;
- static char stc1[] = "1234" ;
- static char *mult[] = { "ab" , "bc" , "de" } ;
-
- printf("Characters:\n\n") ;
-
- printf("ch1\t%c(%d)\n",ch1,ch1) ;
- printf("ch2\t%d\n",ch2) ;
- printf("cha1\t%s\ncha2\t%s\ncha3\t%s\ncha4\t%s\n",
- cha1,cha2,cha3,cha4 ) ;
- printf("cha5\t%s\n\n",cha5) ;
- printf("cha6\t%d, %d, %d\n\t%d, %d, %d\n",
- cha6[0][0],cha6[0][1],cha6[0][2],cha6[1][0],cha6[1][1],cha6[1][2]);
- printf("pch1==cha2\t%s\n",(pch1 == cha2 ? "yes" : "no" ) ) ;
- printf("pch2\t%s\npch3\t%s\n",pch2,pch3+1) ;
- printf("pch4==0\t%s\n\n",(pch4 != 0 ? "no" : "yes" ) ) ;
- printf("stc\t%s\nstc1\t%s\n",stc,stc1) ;
- printf("mult[0],mult[1],mult[2] %s, %s, %s\n",mult[0],mult[1],mult[2]);
-}
-
-#ifndef NOFLOAT
-/* floats */
-
-float fl1 = 0 ;
-float fl2 = 2 ;
-float fl3 = 2e-10 ;
-float fl4 = 4.0 ;
-float fl5 = EPSFLOAT ;
-float fl6 = MAXFLOAT ;
-float fl7 ;
-
-float fla1[4][3] = {
- { 1, 3, 5 },
- { 2, 4, 6 },
- { 3, 5, 7 }
-} ;
-float fla2[4][3] = {
- -1,-3,-5,-2,-4,-6,-3,-5,-7
-} ;
-float fla3[4][3] = {
- { 11 } , { 12 } , { 13 } , { 14 }
-} ;
-
-pflt() {
- register i,j ;
-
- printf("Floats:\n\n") ;
-
-printf("fl1\t%.20e\nfl2\t%.20e\nfl2\t%.20e\nfl4\t%.20e\nfl5\t%.20e\nfl6\t%.20e\nfl7\t%.20e\n",
- fl1,fl2,fl2,fl4,fl5,fl6,fl7 ) ;
-
- printf(" fla1 fla2 fla3\n") ;
- for ( i=0 ; i<4 ; i++ ) {
- for ( j=0 ; j<3 ; j++ ) {
- printf(" %20e %20e %20e\n",
- fla1[i][j],fla2[i][j],fla3[i][j]) ;
- }
- }
-
- printf("\n") ;
-}
-
-/* doubles */
-
-double dbl1 = 0 ;
-double dbl2 = 2 ;
-double dbl3 = 2e-10 ;
-double dbl4 = 4.0 ;
-double dbl5 = EPSDOUBLE ;
-double dbl6 = MAXDOUBLE ;
-double dbl7 ;
-
-double dbla1[4][3] = {
- { 1, 3, 5 },
- { 2, 4, 6 },
- { 3, 5, 7 }
-} ;
-double dbla2[4][3] = {
- -1,-3,-5,-2,-4,-6,-3,-5,-7
-} ;
-double dbla3[4][3] = {
- { 11 } , { 12 } , { 13 } , { 14 }
-} ;
-
-pdbl() {
- register i,j ;
-
- printf("Doubles:\n\n") ;
-
-printf("dbl1\t%.20e\ndbl2\t%.20e\ndbl2\t%.20e\ndbl4\t%.20e\ndbl5\t%.20e\ndbl6\t%.20e\ndbl7\t%.20e\n",
- dbl1,dbl2,dbl2,dbl4,dbl5,dbl6,dbl7 ) ;
-
- printf(" dbla1 dbla2 dbla3\n") ;
- for ( i=0 ; i<4 ; i++ ) {
- for ( j=0 ; j<3 ; j++ ) {
- printf(" %20e %20e %20e\n",
- dbla1[i][j],dbla2[i][j],dbla3[i][j]) ;
- }
- }
-
- printf("\n") ;
-}
-#endif
-
-/* long */
-long lo1 = 14L ;
-long lo2 = -17 ;
-long lo3 = MAXLONG ;
-long lo4 = MINLONG ;
-long lo5 ;
-long lo6 = ( 0==1 ? -1L : 1L ) ;
-
-plong() {
- printf("long\n\n") ;
-
- printf("lo1\t%ld\nlo2\t%ld\nlo3\t%ld\nlo4\t%ld\nlo5\t%ld\nlo6\t%ld\n\n",
- lo1,lo2,lo3,lo4,lo5,lo6 ) ;
-}
-
-/* structures and bit fields */
-
-struct s1 {
- int s_i ;
- char s_ca[3] ;
- long s_l ;
-#ifndef NOFLOAT
- double s_f ;
-#endif
- struct s1 *s_s1 ;
-} ;
-struct s1 st1 ;
-struct s1 sta[3] = {
-#ifndef NOFLOAT
- 1 , { 'a' , 'b' , 'c' } , 10 , -10 , &sta[0] ,
-#else
- 1 , { 'a' , 'b' , 'c' } , 10 , &sta[0] ,
-#endif
- { 2 } ,
- 3
-} ;
-struct s2 {
- int s2_1 :1 ;
- int s2_2 :2 ;
- int s2_3 :4 ;
- int s2_4 :7 ;
- int s2_5 :2 ;
- int s2_6 :11 ;
- int s2_7 :6 ;
-} stb = {
- 1,2,3,4,3,6,7
-} ;
-
-pstruct() {
- printf("structures\n\n") ;
-
- printf("\t st1 sta[0..2]\n") ;
-
- printf("s_i\t%15d%15d%15d%15d\n",
- st1.s_i,sta[0].s_i,sta[1].s_i,sta[2].s_i) ;
- printf("s_ca[0]\t%15d%15d%15d%15d\n",
- st1.s_ca[0],sta[0].s_ca[0],sta[1].s_ca[0],sta[2].s_ca[0]) ;
- printf("s_ca[1]\t%15d%15d%15d%15d\n",
- st1.s_ca[1],sta[0].s_ca[1],sta[1].s_ca[1],sta[2].s_ca[1]) ;
- printf("s_ca[2]\t%15d%15d%15d%15d\n",
- st1.s_ca[2],sta[0].s_ca[2],sta[1].s_ca[2],sta[2].s_ca[2]) ;
- printf("s_l\t%15ld%15ld%15ld%15ld\n",
- st1.s_l,sta[0].s_l,sta[1].s_l,sta[2].s_l) ;
-#ifndef NOFLOAT
- printf("s_f\t %13e %13e %13e %13e\n\n",
- st1.s_f,sta[0].s_f,sta[1].s_f,sta[2].s_f) ;
-#endif
- printf("(sta[0].s_s1)->s_i = %d\n",(sta[0].s_s1)->s_i) ;
-
- printf("\nbit fields:\n\n") ;
- printf("sizeof stb %d\n",sizeof stb) ;
- printf("stb\t%d %d %d %d %d %d %d\n\n",
- stb.s2_1,stb.s2_2,stb.s2_3,stb.s2_4,stb.s2_5,stb.s2_6,stb.s2_7);
-}
-
-main() {
- pint() ;
- pch() ;
-#ifndef NOFLOAT
- pflt() ;
- pdbl() ;
-#endif
- plong() ;
- pstruct() ;
- return(0) ;
-}
+++ /dev/null
-/* $Id$ */
-/*
- * (c) copyright 1987 by the Vrije Universiteit, Amsterdam, The Netherlands.
- * See the copyright notice in the ACK home directory, in the file "Copyright".
- */
-# define MAXINT 32767
-# define MININT -32768
-# define MAXLONG 2147483647
-# define MINLONG -2147483648
-# define EPSFLOAT 2.938736e-39
-# define MAXFLOAT 1.7014117e38
-# define EPSDOUBLE 2.938736e-39
-/* for 64-bit double 1.701411834604692293e38 */
-# define MAXDOUBLE 1.7014117e38
+++ /dev/null
-/*
- * (c) copyright 1987 by the Vrije Universiteit, Amsterdam, The Netherlands.
- * See the copyright notice in the ACK home directory, in the file "Copyright".
- *
- */
-
-/* Author: E.G. Keizer */
-
-char rcs_id[] = "$Id$" ;
-
-main() {
-
- assnull() ;
- ushift() ;
- lshift() ;
- uadd() ;
- return 0 ;
-}
-
-int a,b ;
-assnull() {
- int c,d ;
- /* test a few cases handled especially by the cem-compiler */
-
- a= -1 ; b= -1 ; c= -1 ; d = -1 ;
-
- a=b=0 ;
- c=d=0 ;
- printf("a %d, b %d, c %d, d %d\n",a,b,c,d) ;
- a = b = c = d = -32 ;
- printf (" (a=0) %d, (c=0) %d\n",(a=0),(c=0) ) ;
- printf("a %d, b %d, c %d, d %d\n",a,b,c,d) ;
-
-}
-ushift() {
- unsigned u ;
-
- printf("Unsigned shifts by constants\n") ;
- u = 0150715 ;
- printf(" u = %6o\n",u) ;
- printf(" u>>0 %6o\n", u>>0 ) ;
- printf(" u>>1 %6o\n", u>>1 ) ;
- printf(" u>>2 %6o\n", u>>2 ) ;
- printf(" u>>3 %6o\n", u>>3 ) ;
- printf(" u>>4 %6o\n", u>>4 ) ;
- printf(" u>>5 %6o\n", u>>5 ) ;
- printf(" u>>6 %6o\n", u>>6 ) ;
- printf(" u>>7 %6o\n", u>>7 ) ;
- printf(" u>>8 %6o\n", u>>8 ) ;
- printf(" u>>9 %6o\n", u>>9 ) ;
- printf(" u>>10 %6o\n", u>>10 ) ;
- printf(" u>>11 %6o\n", u>>11 ) ;
- printf(" u>>12 %6o\n", u>>12 ) ;
- printf(" u>>13 %6o\n", u>>13 ) ;
- printf(" u>>14 %6o\n", u>>14 ) ;
- printf(" u>>15 %6o\n", u>>15 ) ;
- if (sizeof(unsigned) > 2) printf(" u>>16 %6o\n", u>>16 ) ;
- printf(" u<<0 %6o\n", u<<0 ) ;
- printf(" u<<1 %6o\n", u<<1 ) ;
- printf(" u<<2 %6o\n", u<<2 ) ;
- printf(" u<<3 %6o\n", u<<3 ) ;
- printf(" u<<4 %6o\n", u<<4 ) ;
- printf(" u<<5 %6o\n", u<<5 ) ;
- printf(" u<<6 %6o\n", u<<6 ) ;
- printf(" u<<7 %6o\n", u<<7 ) ;
- printf(" u<<8 %6o\n", u<<8 ) ;
- printf(" u<<9 %6o\n", u<<9 ) ;
- printf(" u<<10 %6o\n", u<<10 ) ;
- printf(" u<<11 %6o\n", u<<11 ) ;
- printf(" u<<12 %6o\n", u<<12 ) ;
- printf(" u<<13 %6o\n", u<<13 ) ;
- printf(" u<<14 %6o\n", u<<14 ) ;
- printf(" u<<15 %6o\n", u<<15 ) ;
- if (sizeof(unsigned) > 2) printf(" u<<16 %6o\n", u<<16 ) ;
-}
-
-lshift() {
- long ll ;
-
- printf("Long shifts by constants\n") ;
- ll = 400000L - 0532 ;
- printf(" ll = %11lo\n",ll) ;
- printf(" ll>>0 %11lo\n", ll>>0 ) ;
- printf(" ll>>1 %11lo\n", ll>>1 ) ;
- printf(" ll>>2 %11lo\n", ll>>2 ) ;
- printf(" ll>>3 %11lo\n", ll>>3 ) ;
- printf(" ll>>4 %11lo\n", ll>>4 ) ;
- printf(" ll>>5 %11lo\n", ll>>5 ) ;
- printf(" ll>>6 %11lo\n", ll>>6 ) ;
- printf(" ll>>7 %11lo\n", ll>>7 ) ;
- printf(" ll>>8 %11lo\n", ll>>8 ) ;
- printf(" ll>>9 %11lo\n", ll>>9 ) ;
- printf(" ll>>10 %11lo\n", ll>>10 ) ;
- printf(" ll>>11 %11lo\n", ll>>11 ) ;
- printf(" ll>>12 %11lo\n", ll>>12 ) ;
- printf(" ll>>13 %11lo\n", ll>>13 ) ;
- printf(" ll>>14 %11lo\n", ll>>14 ) ;
- printf(" ll>>15 %11lo\n", ll>>15 ) ;
- printf(" ll>>16 %11lo\n", ll>>16 ) ;
- printf(" ll>>17 %11lo\n", ll>>17 ) ;
- printf(" ll>>18 %11lo\n", ll>>18 ) ;
- printf(" ll>>19 %11lo\n", ll>>19 ) ;
- printf(" ll>>20 %11lo\n", ll>>20 ) ;
- printf(" ll>>21 %11lo\n", ll>>21 ) ;
- printf(" ll>>22 %11lo\n", ll>>22 ) ;
- printf(" ll>>23 %11lo\n", ll>>23 ) ;
- printf(" ll>>24 %11lo\n", ll>>24 ) ;
- printf(" ll>>25 %11lo\n", ll>>25 ) ;
- printf(" ll>>26 %11lo\n", ll>>26 ) ;
- printf(" ll>>27 %11lo\n", ll>>27 ) ;
- printf(" ll>>28 %11lo\n", ll>>28 ) ;
- printf(" ll>>29 %11lo\n", ll>>29 ) ;
- printf(" ll>>30 %11lo\n", ll>>30 ) ;
- printf(" ll>>31 %11lo\n", ll>>31 ) ;
- ll = 1 ;
- printf(" ll<<0 %11lo\n", ll<<0 ) ;
- printf(" ll<<1 %11lo\n", ll<<1 ) ;
- printf(" ll<<2 %11lo\n", ll<<2 ) ;
- printf(" ll<<3 %11lo\n", ll<<3 ) ;
- printf(" ll<<4 %11lo\n", ll<<4 ) ;
- printf(" ll<<5 %11lo\n", ll<<5 ) ;
- printf(" ll<<6 %11lo\n", ll<<6 ) ;
- printf(" ll<<7 %11lo\n", ll<<7 ) ;
- printf(" ll<<8 %11lo\n", ll<<8 ) ;
- printf(" ll<<9 %11lo\n", ll<<9 ) ;
- printf(" ll<<10 %11lo\n", ll<<10 ) ;
- printf(" ll<<11 %11lo\n", ll<<11 ) ;
- printf(" ll<<12 %11lo\n", ll<<12 ) ;
- printf(" ll<<13 %11lo\n", ll<<13 ) ;
- printf(" ll<<14 %11lo\n", ll<<14 ) ;
- printf(" ll<<15 %11lo\n", ll<<15 ) ;
- printf(" ll<<16 %11lo\n", ll<<16 ) ;
- printf(" ll<<17 %11lo\n", ll<<17 ) ;
- printf(" ll<<18 %11lo\n", ll<<18 ) ;
- printf(" ll<<19 %11lo\n", ll<<19 ) ;
- printf(" ll<<20 %11lo\n", ll<<20 ) ;
- printf(" ll<<21 %11lo\n", ll<<21 ) ;
- printf(" ll<<22 %11lo\n", ll<<22 ) ;
- printf(" ll<<23 %11lo\n", ll<<23 ) ;
- printf(" ll<<24 %11lo\n", ll<<24 ) ;
- printf(" ll<<25 %11lo\n", ll<<25 ) ;
- printf(" ll<<26 %11lo\n", ll<<26 ) ;
- printf(" ll<<27 %11lo\n", ll<<27 ) ;
- printf(" ll<<28 %11lo\n", ll<<28 ) ;
- printf(" ll<<29 %11lo\n", ll<<29 ) ;
- printf(" ll<<30 %11lo\n", ll<<30 ) ;
-}
-uadd() {
- unsigned u ;
- int i ;
-
- u = 32760 ;
- for ( i=0 ; i<=16 ; ++i ) {
- printf("%2d %6o\n",i,u+i) ;
- }
-}
+++ /dev/null
-/*
- * (c) copyright 1987 by the Vrije Universiteit, Amsterdam, The Netherlands.
- * See the copyright notice in the ACK home directory, in the file "Copyright".
- *
- */
-
-/* Author: E.G. Keizer */
-static char rcs_id[]= "$Id$" ;
-
-/* test for structure parameters, assignment and return */
-# define ASIZE 26
-
-struct w1 {
- int w1_i ;
-} ;
-struct w2 {
- int w2_i ;
- long w2_l ;
-} ;
-struct w3 {
- char w3_a[ASIZE] ;
- unsigned w3_u ;
-} ;
-
-struct w1 es1 ;
-struct w1 es2[3] ;
-
-main() {
- asst() ;
- part() ;
- callt() ;
- return 0 ;
-
-}
-
-asst() {
- /* test structure assignment */
- struct w1 st1, st2, *st3 ;
- struct w2 s2t1, s2t2, *s2t3 ;
- struct w3 s3t1, s3t2, *s3t3 ;
-
-
- register int i ;
-
- printf("w1\n") ;
- st1.w1_i = 506 ;
- st2 = st1 ;
- printf("\tst2.w1_i %d\n",st2.w1_i) ;
- st3 = &st1 ;
- printf("\t(*st3).w1_i %d\n",(*st3).w1_i) ;
- es1.w1_i = 711 ;
- st1 = st2 = es1 ;
- printf("\tst1.w1_i %d\n",st1.w1_i) ;
- printf("\tst2.w1_i %d\n",st2.w1_i) ;
- es2[2] = st1 ;
- printf("\tes2[2].w1_i %d\n",es2[2].w1_i) ;
-
- st1.w1_i = -577 ;
- es1.w1_i = 577 ;
- for ( i=0 ; i<2 ; i++ ) {
- st2 = ( i ? st1 : es1 ) ;
- printf("\tst2.w1_i %d\n",st2.w1_i) ;
- }
-
- st1 = ( i , es1 ) ;
- printf("\tst1.w1_i %d\n",st1.w1_i) ;
-
- printf("w2\n") ;
- s2t1.w2_i = 18000 ;
- s2t1.w2_l = 31415 ;
- s2t2 = s2t1 ;
- printf("\ts2t2: .w2_i %d .w2_l %ld\n",s2t2.w2_i,s2t2.w2_l) ;
- s2t3 = &s2t2 ;
- printf("\ts2t3->w2_l %ld\n",s2t3->w2_l) ;
-
- printf("w3\n") ;
- for ( i = 0 ; i<ASIZE ; i++ ) {
- s3t1.w3_a[i]= 'a'+i ;
- }
- s3t1.w3_u = 0x8000 ;
- s3t2 = s3t1 ;
- s3t3 = &s3t1 ;
- for ( i = 0 ; i<ASIZE ; i++ ) {
- printf("s3t2.w3_a[%2d] %c\n",i,s3t2.w3_a[i]) ;
- }
- printf("s3t2.w3_u %x\n",s3t2.w3_u) ;
- s3t2.w3_u = 1415 ;
- for ( i = 0 ; i<ASIZE ; i++ ) {
- s3t2.w3_a[i]= 'A'+i ;
- }
- *s3t3 = s3t2 ;
- for ( i = 0 ; i<ASIZE ; i++ ) {
- printf("s3t1.w3_a[%2d] %c\n",i,s3t1.w3_a[i]) ;
- }
- printf("s3t1.w3_u %x",s3t1.w3_u) ;
-}
-
-struct w3 epars ;
-
-part() {
- /* test structure parameters */
-
- struct w3 pars ;
-
- register int i ;
-
- for ( i=0 ; i<ASIZE ; i++ ) {
- pars.w3_a[i]=i+1 ;
- }
- pars.w3_u = 281 ;
- printf("\nstructure parameters\n") ;
- psc(-1,pars,1000) ;
-}
-
-psc(before,str,after) int before, after ; struct w3 str ; {
- register int i ;
-
- printf("before %d\n",before) ;
- for ( i=0 ; i<ASIZE ; i++ ) {
- printf("str.w3_a[%2d]\t%d\n",i,str.w3_a[i]) ;
- }
- printf("str.w3_u %x\n",str.w3_u) ;
- printf("after %d\n",after) ;
-}
-
-callt() {
- /* test structure valued functions */
- extern struct w3 setp1(), setp2() ;
- struct w3 myp ;
- register int i ;
-
- printf("\nStucture valued functions\n") ;
- myp = setp1(ASIZE) ;
- printf("myp.w3_a:\n") ;
- for ( i=0 ; i<ASIZE ; i++ ) {
- printf("\t%2d\t%d\n",i,myp.w3_a[i]) ;
- }
-
-
- myp = setp2() ;
- for ( i=0 ; i<ASIZE ; i++ ) {
- printf("\t%2d\t%d\n",i,myp.w3_a[i]) ;
- }
-}
-
-struct w3 setp1(count) {
- struct w3 myp ;
-
- if ( count<=0 ) {
- return(myp) ;
- }
- myp = setp1(count-1) ;
- myp.w3_a[count-1] = 99-count-1 ;
- return(myp) ;
-}
-
-static struct w3 myp2 ;
-
-struct w3 setp2() {
- struct w3 *w3p ;
- register int i ;
-
- for ( i=0 ; i<ASIZE ; i++ ) {
- myp2.w3_a[i]= 99+i ;
- }
- w3p = &myp2 ;
- return(*w3p) ;
-}
+++ /dev/null
-#
-/*
- * (c) copyright 1987 by the Vrije Universiteit, Amsterdam, The Netherlands.
- * See the copyright notice in the ACK home directory, in the file "Copyright".
- *
- */
-
-char rcs_id[] = "$Id$" ;
-
-
-/*
-#define TEST1 1
-*/
-
-
-/* This program can be used to test C-compilers */
-/* It is supposed the first test program (= "test1") */
-/* is used to test the basic arithmetic */
-
-/* The following are global counters */
-
-int t, /* the value indicates the number of the test procedure */
- ect, /* error counter */
- tct; /* count the number of test procedures called */
-
-/************************************************************************/
-/* */
-/* The following is tested: */
-/* FOR STATEMENTS in test1 */
-/* WHILE STATEMENTS in test2 */
-/* WHILE and FOR STATEMENTS in test3 */
-/* DO STATEMENTS in test4 */
-/* SWITCH STATEMENTS in test5\e */
-/* */
-/************************************************************************/
-
-
-
-char *pp1 = "End of test program, ";
-char *pp2 = " test(s) completed, ";
-char *pp3 = " errors detected\n";
-char *pp4 = "Error ";
-char *pp5 = " in test";
-char *pp6 = "\n";
-
-itoa(p,ptr)
-/* converts integer "p" to ascii string "ptr" */
-int p;
-char *ptr;
-{
- register int k,l;
- register char *str;
- int sign;
-
- str=ptr;
- k=p;
- if ((sign=k)<0)
- k = -k;
- do
- {
- l = k % 10;
- k /= 10;
- *str++ = l + '0';
- }
- while(k);
- if (sign<0)
- *str++ = '-';
- *str = '\0';
- reverse(ptr);
-}
-
-
-
-reverse(s)
-char s[];
-{
- register int c,i,j;
-
- for (i=0, j=strlen(s)-1; i<j; i++, j--)
- {
- c=s[i];
- s[i]=s[j];
- s[j]=c;
- }
-}
-
-strlen(str)
-/* returns the length of string str */
-char *str;
-{
- register char *s, *p;
-
- p = s = str;
- while (*p)
- p++;
- return(p-s);
-}
-
-
-
-main()
-{
- char chtct[10],chect[10];
- tct = 0;
- ect = 0; /* No errors, so far so good */
- test1(); /* testing FOR STATEMENTS */
- test2(); /* testing WHILE STATEMENTS */
- test3(); /* testing combined FOR and WHILE statements */
- test4(); /* testing DO statements */
- test5(); /* testing SWITCH statements */
- test6(); /* testing GOTO statements */
- test7();
- test8();
- write(1,pp1,strlen(pp1));
- itoa(tct,chtct);
- write(1,chtct,strlen(chtct));
- write(1,pp2,strlen(pp2));
- itoa(ect,chect);
- write(1,chect,strlen(chect));
- write(1,pp3,strlen(pp3));
- return(ect);
-}
-
-
-
-e(n) /* prints an error message */
-int n;
-{
- char cht[10],chn[10];
- ect++; /* total number of errors increased by 1 */
- write(1,pp4,strlen(pp4));
- itoa(n,chn);
- write(1,chn,strlen(chn));
- write(1,pp5,strlen(pp5));
- itoa(t,cht);
- write(1,cht,strlen(cht));
- write(1,pp6,strlen(pp6));
- abort();
-}
-
-
-
-test1() /* Testing the for statement */
-{
- int i, j; /* variables, used as contolling integers in the */
- /* for statements */
-
- t = 1; /* This is test 1 */
- tct++;
- for ( ; ; )
- {
- break;
- e(1);
- return; /* If the break doesn't work, let's hope the */
- /* return does ! */
- }
- for ( ; ; )
- {
- for ( ; ; )
- {
- for ( ; ; )
- {
- for ( ; ; )
- {
- for ( ; ; )
- {
- for ( ; ; )
- {
- break;
- e(2);
- return;
- }
- break;
- e(3);
- return;
- }
- break;
- e(4);
- return;
- }
- break;
- e(5);
- return;
- }
- break;
- e(6);
- return;
- }
- break;
- e(7);
- return;
- }
- i=0;
- for ( ; ; i++)
- {
- break;
- e(8);
- return;
- }
- for (i=0 ; ; i++)
- {
- break;
- e(9);
- return;
- }
- for (i=0 ; i<3; i++)
- ;
- if (i != 3) e(10);
- for (i=0; i<0; i++)
- e(11);
- if (i != 0) e(12);
- for (i=0; i<1; i++)
- for (i=i; i<i; i++)
- for (i=i; i<(i+0); i++)
- for (i=i+0; i<(i-0); i++)
- for (i=i-0; i<i; i++)
- e(13);
- if (i != 1) e(14);
- for (i=0; i<3; )
- i++;
- if (i != 3) e(15);
- i = 18;
- j = 3;
- for ( ; j<i; --i)
- ;
- if (i != j) e(16);
- if (i != 3) e(17);
- j = -30;
- for ( ; ; )
- if (++j)
- continue;
- else break;
- if (j != 0) e(18);
- i = 0;
- for (i++, i++, i++, i++; ; )
- {
- if (i != 4) e(19);
- break;
- }
- i = 1;
- for (i=j=i=j=i=j=i; i && j && i; --i, --j)
- {
- if (i != 1) e(20);
- }
- j=0;
- for (i=32700; i<32767; i++)
- j++;
- if (j != 67) e(21);
- j=0;
-#ifdef TEST1
- printf("*** 1\n");
- for (i=32000; i<=32767; i++)
- j++;
- if (j != 68) e(22);
- printf("*** 2\n");
-#endif
- j=0;
- for (i=32767; i>32700; i--)
- j++;
- if (j != 67) e(23);
- j=0;
- for (i= -32768; i<-32700; i++)
- j++;
- if (j != 68) e(24);
-}
-
-
-
-
-test2() /* Testing the while statement */
-{
- int i, j;
-
- t = 2;
- tct++;
- while(1)
- {
- break;
- e(1);
- return;
- }
- while(0)
- {
- e(2);
- break;
- e(3);
- return;
- }
- while (1 || 0)
- {
- break;
- e(4);
- return;
- }
- while (1 && 0)
- {
- e(5);
- break;
- e(6);
- return;
- }
- j = 10;
- while (--j)
- ;
- if (j != 0) e(7);
- while (j)
- {
- e(8);
- break;
- }
- while ( i=j )
- {
- e(9);
- break;
- }
- while ( (i==j) && (i!=j) )
- {
- e(10);
- break;
- }
- j = 1;
- while (j)
- while(j)
- while(j)
- while(j)
- while(j)
- while(--j)
- ;
- if (j != 0) e(11);
- if (j) e(12);
- j = 30;
- while (--j)
- {
- continue;
- continue;
- continue;
- continue;
- continue;
- break;
- e(13);
- }
-}
-
-
-
-
-test3() /* Combined FOR and WHILE statements */
-{
- int i,j;
-
- t = 3;
- tct++;
- j = 0;
- for (i=3; i; i++)
- {
- while (i--)
- ;
- if (++j > 1) e(1);
- }
-}
-
-
-
-
-test4() /* Do statement */
-{
- int i;
-
- t = 4;
- tct++;
- i = 0;
- do
- if (i) e(1);
- while (i);
- do
- {
- do
- {
- do
- {
- do
- {
- i++;
- }
- while (!i);
- i++;
- }
- while (!i);
- i++;
- }
- while (!i);
- i++;
- }
- while (!i);
- if (i != 4) e(2);
-}
-
-
-
-
-test5() /* SWITCH statement */
-{
- int i,j;
-
- t = 5;
- tct++;
- for (i=0; i<10; i++)
- {
- switch (i)
- {
- case 0: if (i != 0) e(1);
- break;
- case 1: if (i != 1) e(2);
- break;
- case 2: if (i != 2) e(3);
- break;
- case 3: if (i != 3) e(4);
- i++;
- case 4: if (i != 4) e(5);
- case 5:
- case 6:
- case 7:
- case 8:
- case 9:
- break;
- default: e(6);
- }
- }
- for (i=j= -18; i<10; i++, j++)
- {
- switch (i)
- {
- case -3:
- case 7:
- case 1: switch (j)
- {
- case -3:
- case 7:
- case 1:
- break;
- default: e(7);
- }
- break;
- e(8);
- case -4: switch (j)
- {
- case -4: if (i != -4) e(9);
- break;
- default: e(10);
- }
- }
- }
- i = 'a';
- switch (i)
- {
- case 'a':
- switch ( i )
- {
- case 'a':
- switch ( i )
- {
- case 'a':
- break;
- default: e(11);
- }
- break;
- default: e(12);
- }
- break;
- default: e(13);
- }
-}
-
-
-
-test6() /* goto statement */
-{
- int k;
-
- t = 6;
- tct++;
- k = 0;
- goto lab0;
-xl1:
- k = 1;
- goto lab1;
-xl2:
- k = 2;
- goto lab2;
-xl3:
- k = 3;
- goto lab3;
-xl4:
- k = 4;
- goto llab1;
-llab2: goto llab3;
-llab4: goto llab5;
-llab6: goto llab7;
-llab8: if ( k != 4 ) e(5);
- return ;
-llab1: goto llab2;
-llab3: goto llab4;
-llab5: goto llab6;
-llab7: goto llab8;
-lab0: if ( k!= 0 ) e(1);
- goto xl1 ;
-lab1: if ( k!= 1 ) e(2);
- goto xl2 ;
-lab2: if ( k!= 2 ) e(3);
- goto xl3 ;
-lab3: if ( k!= 3 ) e(4);
- goto xl4 ;
-}
-
-
-
-test7() /* Combinations of FOR, WHILE, DO and SWITCH statements */
-{
- int i,j,k;
-
- t = 7;
- tct++;
- for ( i=j=k=0; i<6; i++, j++, k++ )
- {
- if ( i != j ) e(1);
- if ( i != k ) e(2);
- if ( j != k ) e(3);
- while ( i > j )
- {
- e(4);
- break;
- }
- while ( i > k )
- {
- e(5);
- break;
- }
- while ( j != k )
- {
- e(6);
- break;
- }
- switch(i)
- {
- case 0:
- switch(j)
- {
- case 0:
- switch(k)
- {
- case 0: if ( i+j+k != 0 ) e(7);
- break;
- e(8);
- default: if ( i+j+k != k ) e(9);
- }
- break;
- default: if ( j > 6 ) e(10);
- if ( k != j ) e(11);
- }
- break;
- case 1:
- case 2:
- case 3:
- case 4:
- case 5: break;
- default: e(12);
- }
- }
- for ( i=j= -3; i<0; i++,j++)
- if ( j == -3 )
- do
- if ( i )
- switch ( i )
- {
- case -3: if ( j != i ) e(13);
- case -2: if ( j != i ) e(14);
- case -1: for ( k=i; k < 2*j-j; k++)
- {
- e(15);
- break;
- }
- break;
- case 0: e(16);
- break;
- default: e(17);
- break;
- }
- else e(18);
- while ( 0 );
- if ( i != j ) e(19);
-}
-
-
-
-
-test8()
-{
- int *p1, *p2;
- int i,j,k;
- int a1[1], a2[2][2], a3[3][3][3];
-
- t = 8;
- tct++;
- a1[0] = 0;
- for ( i=0; i<2; i++ )
- for ( j=0; j<2; j++ )
- a2[i][j] = (i*j) ^ (i+j);
- if ( a2[0][0] != 0 ) e(1);
- if ( a2[0][1] != 1 ) e(2);
- if ( a2[1][0] != a2[0][1] ) e(3);
- for ( i=0; i<3; i++)
- for (j=0; j<3; j++)
- for (k=0; k<3; k++)
- a3[i][j][k] = i | j | k;
- if ( a3[0][0][0] != 0 ) e(4);
- if ( a3[0][1][2] != a3[2][0][1] ) e(5);
- if ( a3[2][1][1] != (2 | 1 | 1) ) e(6);
- p2 = &a3[0][1][2];
- p1 = &a3[0][1][2];
- for ( ; p1 == p2 ; p1++ )
- {
- switch ( *p1 )
- {
- case 3: break;
- default: e(7);
- }
- if ( *p1 != *p2 ) e(8);
- }
-}
+++ /dev/null
-/*
- * (c) copyright 1987 by the Vrije Universiteit, Amsterdam, The Netherlands.
- * See the copyright notice in the ACK home directory, in the file "Copyright".
- *
- */
-
-char rcs_id[] = "$Id$" ;
-
-/* C-compiler test 1 */
-/* This program can be used to test C-compilers */
-
-#ifndef NOFLOAT
-# define EPSD 1e-5
-# define EPSF 1e-5
-#endif
-
-/* global counters */
-
-int t, /* the value indicates the number of the test procedure */
- ect, /* error counter */
- tct; /* count the number of test procedures called */
-
-/****************************************************************************/
-/*
- * The following is tested:
- * INTEGER CONSTANTS in test1
- * GLOBAL INTEGER VARIABLES in test2
- * LOCAL INTEGER VARIABLES in test3
- * GLOBAL LONG VARIABLES in test4
- * LOCAL LONG VARIABLES in test5
- * REAL ARITHMETIC in test6
- * GLOBAL RECORDS in test7
- * LOCAL RECORDS in test8
- * GLOBAL ARRAYS in test9
- * LOCAL ARRAYS in test10
- * GLOBAL POINTERS in test11
- */
-/***************************************************************************/
-char alstr[1000] ;
-char *alptr = alstr ;
-
-char *alloc(size) {
- register char *retval ;
-
- retval=alptr ;
- alptr += size ;
- if ( alptr-alstr>sizeof alstr ) {
- printf("allocation overflow\n") ;
- exit(8) ;
- }
- return(retval) ;
-}
-
-#ifndef NOFLOAT
-double fabs(a) double a ; { return( a<0 ? -a : a) ; }
-#endif
-
-
-
-/* global variables for the test procedures */
-
-int i,j,k,l,m;
-
-long li,lj,lk,ll,lm;
-
-#ifndef NOFLOAT
-float xf, yf, zf;
-
-double xd, yd, zd;
-#endif
-
-struct tp2 {
- char c1;
- int i,j;
-#ifndef NOFLOAT
- float aaa;
- double bbb;
-#endif
-} r1, r2;
-
-int p, *p1, *p11, **p2, ***p3, ****p4, *****p5;
-
-struct tp2 *pp1, *pp2, *pp3;
-int a1[20];
-#ifndef NOFLOAT
-float a2[20];
-double a3[20];
-#endif
-
-main()
-{
- tct = 0;
- ect = 0;
- test1();
- test2();
- test3();
- test4();
- test5();
- test6();
- test7();
- test8();
- test9();
- test10();
-#ifndef NOFLOAT
- test11();
-#endif
- printf("End of test program, %d tests completed, %d errors detected\n",
- tct,ect);
- return 0 ;
-}
-
-
-
-e(n)
-int n;
-{
- ect++;
- printf("Error %d in test%d \n",n,t);
-}
-
-
-
-test1() /* testing integer constants */
-{
- t = 1;
- tct++;
- if (0) e(1);
- if (!1) e(2);
- if ( 1+2 != 3 ) e(3);
- if (-500 - 234 != -734) e(4);
- if (-32 + 155 != 123) e(5);
- if ( 2*3 != 6) e(6);
- if ( 3*4*5*6 != 360) e(7);
- if ( 654-3*2 != 648) e(8);
- if (5*5 + 5*5 != 50) e(9);
- if ( 1+1-1+1-1+1-1+1-1+1 != 2) e(10);
-/**********************************************************************/
- if ( ((((((((((((((((((((0)))))))))))))))))))) ) e(11);
- if ( (((-2))) - ((((-3)))) * (3+((2))) != 13 ) e(12);
- if ( 1+1 != 2 ) e(13);
- if ( 3333 + 258 != 3591) e(14);
- if (3*4 != 12) e(15);
- if (111*111 != 12321) e(16);
- if (50 / 5 != 10) e(17);
- if (7498 / 75 != 99) e(18);
- if (456 - 345 != 111) e(19);
- if (1+(-2) != -1) e(20);
- if (-3 * -4 != 12) e(21);
- if (-2 / 2 != -1) e(22);
- if (-5 / 1 != -5) e(23);
- if (-4 - -5 != 1) e(24);
- if ( 03 + 02 != 05) e(25);
- if ( 03456 + 88 != 03606 ) e(26);
- if ( 0100 * 23 != 02700 ) e(27);
- if ( 045 / 020 != 2 ) e(28);
- if ( 0472 - 0377 != 073 ) e(29);
- if ( 'a' != 'a' ) e(30);
- if ( 'a' + 'c' != 'b' + 'b' ) e(31);
- if ( 'z' * 'z' != 14884 ) e(32);
- if ( -'z' / 01 != -'z' ) e(33);
- if ( 077777 >> 3 != 07777 ) e(34);
- if ( 077777 >> 15 ) e(35);
- if ( ( 0124 & 07765 ) != 0124 ) e(37);
- if ( ( 34 & 31 ) != 2 ) e(38);
- if (( 5 | 013 | 020 ) != 31 ) e(39);
- if ( ( -7 ^ 3 ) != -6 ) e(40);
- if ( (07373 ^ 4632 ) != 016343 ) e(41);
- if ( (1+2+3)*(2+3+4)*(3+5+5) / 2 != ((3*((5+3+2)*10)+51)*6)/6 ) e(42);
- if ( (1000*2+5*7+13)/8 != 2*2*2*2*4*4 ) e(43);
- if ( ( 1*2*3*4*5*6*7 / 5040 ) != 5040 / 7 / 6 / 5 / 4 / 3 / 2 / 1 ) e(44);
- if ( (-(-(-(-(-(-(1))))))) != 1) e(45);
- if ( - 1 != -((((((((1)))))))) ) e(46);
- if ( -1-1-1-1-1-1 != -6+3-3 ) e(47);
- if ( 2<1 ) e(48);
- if ( 2==3 ) e(49);
- if ( 2 != 2 ) e(50);
- if ( 2>3 ) e(51);
- if ( 2+0 != 2 ) e(52);
- if ( 2-0 != 2 ) e(53);
- if ( 2*0 != 0 ) e(54);
- if ( 0/1 != 0 ) e(55);
- if ( 0*0 != 0 ) e(56);
- if (32767 > 32767) e(57);
- if ( -32768 > -32767 ) e(58);
- if ( 0456 < 0400 ) e(59);
- if ( 0456 != ( 0400 | 050 | 06 ) ) e(60);
- if ( 2*2 + (2<<2) != 12 ) e(61);
- if ( 0 || 0 ) e(62);
- if ( 1 && 0 ) e(63);
- if ( ( 123 ? 123*4 : 345 ) != 492 ) e(64);
- if ( ( 0 ? 345 : 280 ) != 280 ) e(65);
- if ( ( 4>>10 ) + 3 != 3 ) e(66);
- if ( ! ( 111 || 23 && 0 ) ) e(67);
- if ( !1 ) e(68);
- if ( !0 == 0 ) e(69);
- if ( !!!!!!!!!!0 ) e(70);
- if ( 2*2*2*2 != 4*4 ) e(71);
- if ( 0 && 0 && 0 && 0000 && 000000000000 ) e(72);
- if ( 1 & 1 & 1 && 1 & 1 && 1 & 0 ) e(73);
- if ( 01 + 01 + 01 != 1 + 1 + 1 ) e(74);
- if ( 07 + 1 != 010 ) e(75);
- if ( ('a' & 017777) != 'a' ) e(76);
- if ( ( 3 >> 0 ) != 3 ) e(77);
- if ( ( 3 << 0 ) != 3 ) e(78);
- if ( ((((((((((3)))))))))) << ((((((((((((2)))))))))))) != 12 ) e(79);
- if ( (((3 << 4)) >> 4) != 3 ) e(80);
- if ( (2+'a')*'b' != 2*'b' + 'a'*'b' ) e(81);
- if ( 'a' * 'a' < 0 ) e(82);
- if ( ('a'-'a'+'a'-'a'+('a'-'a')*'h') >> 3 ) e(82);
- if ( 'z' - 01 != 'y' + 00 ) e(83);
- if ( 'a' ^ 'a' ) e(84);
- if ( 'h' ^ 'h' ^ 'a' ^ 'a' ) e(85);
- if ( 0567 ^ (0500 | 060 | 7 ) ) e(86);
- if ( 0 ^ 0 ^ 0 ^ 00 ) e(87);
- if ( ( !0 ) ^ (!0) ) e(88);
- if ( ( !!!40 ) ^ (!!!050) ) e(89);
- if ( ( 6^7 ) * 345 != 345 ) e(90);
- if ( !!!!!!!!!!!!! 'k' ) e(91);
- if ( !!!((('k'))) ) e(92);
- if ( -0 != 0 ) e(93) ;
-}
-
-
-
-
-test2() /* testing global integer variables */
-{
- t = 2;
- tct++;
- i = 1;
- j = 2;
- k = 3;
- l = 4;
- m = 10;
- if ( i + j != k ) e(1);
- if ( i + k != l ) e(2);
- if ( j - k != -i ) e(3);
- if ( j*(j+k) != m ) e(4);
- if ( -m != -(k+k+l) ) e(5);
- if ( i/i != 1 ) e(6);
- if ( m*m / m != m ) e(7);
- if ( 10*m != 100 ) e(8);
- if ( m * (-10) != -100 ) e(9);
- if ( j/k != 0 ) e(10);
- if ( 100/k != 33 ) e(11);
- if ( i+j*k+l+m / j+50 / k != 32 ) e(12);
- if ( j*k*m / 6 != 10 ) e(13);
- if ( (k>4) || (k>=4) || (k==4) ) e(14);
- if ( (m<j) || (m<=j) || (m==j) ) e(15);
- if ( i+j-k ) e(16);
- if ( j<i ) e(17);
- if ( j != j ) e(18);
- if ( i>j ) e(19);
- if ( (i>j ? k : k*j) != 6 ) e(20);
- if ( (i<j ? k : k*j) != 3 ) e(21);
- if ( j<<i != l ) e(22);
- if ( j>> i != i ) e(25);
- if ( i++ != 1 ) e(26);
- if ( --i != 1 ) e(27);
- if ( i-- != 1 ) e(28);
- if ( (i+j) && (i<0) || (m-10) && (064) ) e(29);
- if ( (i+j) && !(i>=0) || (m-10) && !(0) ) e(30);
- i = 2;
- j = 4;
- k = 8;
- l = 16;
- m = 32;
- if ( i != 02 ) e(31);
- if ( j != 04 ) e(32);
- if ( k != 010 ) e(33);
- if ( l != 020 ) e(34);
- if ( i & j ) e(35);
- if ( i & j & k & l & m ) e(36);
- if ( ! ( i & j & k & l & m | i ) ) e(37);
- if ( ( i >> 0 ) != i ) e(38);
- if ( (( i/i ) << 1 ) != 02 ) e(39);
- if ( ( i | (j) | (k) | (l) | (m) ) != i+j+k+l+m ) e(40);
- if (!(i^j) ) e(41);
- if ( !(i^j^k^l^m) ) e(42);
- if ( ( --i << 1 ) != 2 ) e(43);
- if ( ( i << 01 ) != 2 ) e(44);
- if ( i%j != i ) e(45);
- if ( k%l != k ) e(46);
- if (( (m/l) << i >> i ) != 2 ) e(47);
- if ( (i = j = k = l = m) != m ) e(48);
- if ( ( i!=j ) || ( j!=k ) || !(l==m) ) e(49);
- if ( (i<j) || (j>i) || (k<m) ) e(50);
- if ( (i%j) || (j%i) || (k%l) || (m%l) ) e(51);
- if ( (i% (j<<0) + ((j<<3)>>3)%(i/i)) ) e(52);
- if ( ! ( i++ == j++ ) ) e(53);
- if ( i != j ) e(54);
- if ( i++ != (j++) ) e(55);
- i = 1;
- j = i + 1;
- if ( -i != -i ) e(56);
- if ( i != --j ) e(57);
- if ( (((((i))))) != -(-(-(-(i)))) ) e(59);
- if ( j != 1 ) e(60);
-}
-
-
-
-
-test3() /* testing local integer variables */
-{
- int a,b,c,d,f;
-
- t = 3;
- tct++;
- a = 1;
- b = 2;
- c = 3;
- d = 4;
- f = 10;
- if ( a + b != c ) e(1);
- if ( a + c != d ) e(2);
- if ( b - c != -a ) e(3);
- if ( b*(b+c) != f ) e(4);
- if ( -f != -(c+c+d) ) e(5);
- if ( a/a != 1 ) e(6);
- if ( f*f / f != f ) e(7);
- if ( 10*f != 100 ) e(8);
- if ( f * (-10) != -100 ) e(9);
- if ( b/c != 0 ) e(10);
- if ( 100/c != 33 ) e(11);
- if ( a+b*c+d+f / b+50 / c != 32 ) e(12);
- if ( b*c*f / 6 != 10 ) e(13);
- if ( (c>4) || (c>=4) || (c==4) ) e(14);
- if ( (f<b) || (f<=b) || (f==b) ) e(15);
- if ( a+b-c ) e(16);
- if ( b<a ) e(17);
- if ( b != b ) e(18);
- if ( a>b ) e(19);
- if ( (a>b ? c : c*b) != 6 ) e(20);
- if ( (a<b ? c : c*b) != 3 ) e(21);
- if ( b<<a != d ) e(22);
- if ( b>> a != a ) e(25);
- if ( a++ != 1 ) e(26);
- if ( --a != 1 ) e(27);
- if ( a-- != 1 ) e(28);
- if ( (a+b) && (a<0) || (f-10) && (064) ) e(29);
- if ( (a+b) && !(a>=0) || (f-10) && !(0) ) e(30);
- a = 2;
- b = 4;
- c = 8;
- d = 16;
- f = 32;
- if ( a != 02 ) e(31);
- if ( b != 04 ) e(32);
- if ( c != 010 ) e(33);
- if ( d != 020 ) e(34);
- if ( a & b ) e(35);
- if ( a & b & c & d & f ) e(36);
- if ( ! ( a & b & c & d & f | a ) ) e(37);
- if ( ( a >> 0 ) != a ) e(38);
- if ( (( a/a ) << 1 ) != 02 ) e(39);
- if ( ( a | (b) | (c) | (d) | (f) ) != a+b+c+d+f ) e(40);
- if (!(a^b) ) e(41);
- if ( !(a^b^c^d^f) ) e(42);
- if ( ( --a << 1 ) != 2 ) e(43);
- if ( ( a << 01 ) != 2 ) e(44);
- if ( a%b != a ) e(45);
- if ( c%d != c ) e(46);
- if (( (f/d) << a >> a ) != 2 ) e(47);
- if ( (a = b = c = d = f) != f ) e(48);
- if ( ( a!=b ) || ( b!=c ) || !(d==f) ) e(49);
- if ( (a<b) || (b>a) || (c<f) ) e(50);
- if ( (a%b) || (b%a) || (c%d) || (f%d) ) e(51);
- if ( (a%(b<<0) + ((b<<3)>>3)%(a/a)) ) e(52);
- if ( ! ( a++ == b++ ) ) e(53);
- if ( a != b ) e(54);
- if ( a++ != (b++) ) e(55);
- a = 1;
- b = a + 1;
- if ( -a != -a ) e(56);
- if ( a != --b ) e(57);
- if ( (((((a))))) != -(-(-(-(a)))) ) e(59);
- if ( b != 1 ) e(60);
-}
-
-
-
-
-test4() /* testing global long variables */
-{
- t = 4;
- tct++;
- li = 1;
- lj = 2;
- lk = 3;
- ll = 4;
- lm = 10;
- if ( li + lj != lk ) e(1);
- if ( li + lk != ll ) e(2);
- if ( lj - lk != -li ) e(3);
- if ( lj*(lj+lk) != lm ) e(4);
- if ( -lm != -(lk+lk+ll) ) e(5);
- if ( li/li != 1 ) e(6);
- if ( lm*lm / lm != lm ) e(7);
- if ( 10*lm != 100 ) e(8);
- if ( lm * (-10) != -100 ) e(9);
- if ( lj/lk != 0 ) e(10);
- if ( 100/lk != 33 ) e(11);
- if ( li+lj*lk+ll+lm / lj+50 / lk != 32 ) e(12);
- if ( lj*lk*lm / 6 != 10 ) e(13);
- if ( (lk>4) || (lk>=4) || (lk==4) ) e(14);
- if ( (lm<lj) || (lm<=lj) || (lm==lj) ) e(15);
- if ( li+lj-lk ) e(16);
- if ( lj<li ) e(17);
- if ( lj != lj ) e(18);
- if ( li>lj ) e(19);
- if ( (li>lj ? lk : lk*lj) != 6 ) e(20);
- if ( (li<lj ? lk : lk*lj) != 3 ) e(21);
- if ( lj<<li != ll ) e(22);
- if ( lj>> li != li ) e(25);
- if ( li++ != 1 ) e(26);
- if ( --li != 1 ) e(27);
- if ( li-- != 1 ) e(28);
- if ( (li+lj) && (li<0) || (lm-10) && (064) ) e(29);
- if ( (li+lj) && !(li>=0) || (lm-10) && !(0) ) e(30);
- li = 2;
- lj = 4;
- lk = 8;
- ll = 16;
- lm = 32;
- if ( li != 02 ) e(31);
- if ( lj != 04 ) e(32);
- if ( lk != 010 ) e(33);
- if ( ll != 020 ) e(34);
- if ( li & lj ) e(35);
- if ( li & lj & lk & ll & lm ) e(36);
- if ( ! ( li & lj & lk & ll & lm | li ) ) e(37);
- if ( ( li >> 0 ) != li ) e(38);
- if ( (( li/li ) << 1 ) != 02 ) e(39);
- if ( ( li | (lj) | (lk) | (ll) | (lm) ) != li+lj+lk+ll+lm ) e(40);
- if (!(li^lj) ) e(41);
- if ( !(li^lj^lk^ll^lm) ) e(42);
- if ( ( --li << 1 ) != 2 ) e(43);
- if ( ( li << 01 ) != 2 ) e(44);
- if ( li%lj != li ) e(45);
- if ( lk%ll != lk ) e(46);
- if (( (lm/ll) << li >> li ) != 2 ) e(47);
- if ( (li = lj = lk = ll = lm) != lm ) e(48);
- if ( ( li!=lj ) || ( lj!=lk ) || !(ll==lm) ) e(49);
- if ( (li<lj) || (lj>li) || (lk<lm) ) e(50);
- if ( (li%lj) || (lj%li) || (lk%ll) || (lm%ll) ) e(51);
- if ( (li%(lj<<0) + ((lj<<3)>>3)%(li/li)) ) e(52);
- if ( ! ( li++ == lj++ ) ) e(53);
- if ( li != lj ) e(54);
- if ( li++ != (lj++) ) e(55);
- li = 1;
- lj = li + 1;
- if ( -li != -li ) e(56);
- if ( li != --lj ) e(57);
- if ( (((((li))))) != -(-(-(-(li)))) ) e(59);
- if ( lj != 1 ) e(60);
- li = 40000;
- lj = 80000;
- lk = 800000L;
- ll = -800000L;
- lm = 1200000L;
- if ( lk != -ll ) e(61);
- if ( 10 * li != 400000L ) e(62);
- if ( 2 * li != lj ) e(63);
- if ( -(-(-(-(li)))) != li ) e(64);
- if ( 10 * lj != lk ) e(65);
- if ( lm + lm != 2 * lm ) e(66);
- if ( lm - lm ) e(67);
- if ( lk / lk != 1 ) e(68);
- if ( lk / lj != 10 ) e(69);
- if ( lm / li != 30 ) e(70);
- if ( li + lj != lm / 10 ) e(71);
- if ( li - 40000 - 1 != lk - 800001L ) e(72);
- if ( li + li + li + li +li + li != lj + lj + lj ) e(73);
- if ( li > lj ) e(74);
- if ( lj > lk ) e(75);
- if ( lm < ll ) e(76);
- if ( (lm<1000000L) || (((lk-lj-lj*10)>0)) ) e(77);
- if ( lm / 01 != lm ) e(78);
- if ( lm * 01 != lm ) e(79);
- if ( lm + 'a' != lm + 'b' -1 ) e(80);
- if ( (lm % 'a') % 'a' != lm % 'a' ) e(81);
- if ( lm % lm ) e(82);
- if ( lj % li ) e(83);
- if ( (lm<<1) != lm * 2 ) e(84);
- if ( ! ( ( --lm % li ) + 1 ) ) e(86);
- if ( ( lj >> 1 ) ^ li ) e(87);
- li = 1;
- if ( li != 1 ) e(89);
- li <<= 20;
- lj = 2;
- if ( (lj<<19) != li ) e(90);
- li = lj = lk= ll = lm = -345678L;
- if ( (li != lj) || (lj != lk) || (ll != lm) ) e(91);
- if ( (li != lj) || (lj != lk) || (lk != ll) || (ll != lm) ) e(92);
- if ( li != -345678L ) e(93);
- li = 1 | 2;
- li <<= 20;
- lj = li & li & li & li & li | li | li | li;
- if ( li != lj ) e(94);
- if ( ! ( li & lj ) ) e(95);
- if ( li ^ lj ) e(96);
- if ( ! (li | lj) ) e(97);
- if ( (li >> 20) != 3 ) e(98);
- li = 20000;
- li *= 2;
- if ( li < 0 ) e(99);
- if ( 1 * li != li ) e(100);
- lj = 20000;
- if ( (lj<<1) != li ) e(101);
- if ( (5*lj)/10 != lj/2 ) e(102);
- if ( 4*lj != 1*01*2*2*lj ) e(103);
- li = lj = 30000;
- if ( li != li * lj / 30000 ) e(104);
- if ( ++li != ++lj ) e(105);
- lk = 5;
- ll = 150000L;
- if ( lk * (li-1) != ll ) e(106);
-}
-
-
-
-
-test5() /* testing local long variables */
-{
- long la, lb, lc, ld, lf;
-
- t = 5;
- tct++;
- la = 1;
- lb = 2;
- lc = 3;
- ld = 4;
- lf = 10;
- if ( la + lb != lc ) e(1);
- if ( la + lc != ld ) e(2);
- if ( lb - lc != -la ) e(3);
- if ( lb*(lb+lc) != lf ) e(4);
- if ( -lf != -(lc+lc+ld) ) e(5);
- if ( la/la != 1 ) e(6);
- if ( lf*lf / lf != lf ) e(7);
- if ( 10*lf != 100 ) e(8);
- if ( lf * (-10) != -100 ) e(9);
- if ( lb/lc != 0 ) e(10);
- if ( 100/lc != 33 ) e(11);
- if ( la+lb*lc+ld+lf / lb+50 / lc != 32 ) e(12);
- if ( lb*lc*lf / 6 != 10 ) e(13);
- if ( (lc>4) || (lc>=4) || (lc==4) ) e(14);
- if ( (lf<lb) || (lf<=lb) || (lf==lb) ) e(15);
- if ( la+lb-lc ) e(16);
- if ( lb<la ) e(17);
- if ( lb != lb ) e(18);
- if ( la>lb ) e(19);
- if ( (la>lb ? lc : lc*lb) != 6 ) e(20);
- if ( (la<lb ? lc : lc*lb) != 3 ) e(21);
- if ( lb<<la != ld ) e(22);
- if ( lb>> la != la ) e(25);
- if ( la++ != 1 ) e(26);
- if ( --la != 1 ) e(27);
- if ( la-- != 1 ) e(28);
- if ( (la+lb) && (la<0) || (lf-10) && (064) ) e(29);
- if ( (la+lb) && !(la>=0) || (lf-10) && !(0) ) e(30);
- la = 2;
- lb = 4;
- lc = 8;
- ld = 16;
- lf = 32;
- if ( la != 02 ) e(31);
- if ( lb != 04 ) e(32);
- if ( lc != 010 ) e(33);
- if ( ld != 020 ) e(34);
- if ( la & lb ) e(35);
- if ( la & lb & lc & ld & lf ) e(36);
- if ( ! ( la & lb & lc & ld & lf | la ) ) e(37);
- if ( ( la >> 0 ) != la ) e(38);
- if ( (( la/la ) << 1 ) != 02 ) e(39);
- if ( ( la | (lb) | (lc) | (ld) | (lf) ) != la+lb+lc+ld+lf ) e(40);
- if (!(la^lb) ) e(41);
- if ( !(la^lb^lc^ld^lf) ) e(42);
- if ( ( --la << 1 ) != 2 ) e(43);
- if ( ( la << 01 ) != 2 ) e(44);
- if ( la%lb != la ) e(45);
- if ( lc%ld != lc ) e(46);
- if (( (lf/ld) << la >> la ) != 2 ) e(47);
- if ( (la = lb = lc = ld = lf) != lf ) e(48);
- if ( ( la!=lb ) || ( lb!=lc ) || !(ld==lf) ) e(49);
- if ( (la<lb) || (lb>la) || (lc<lf) ) e(50);
- if ( (la%lb) || (lb%la) || (lc%ld) || (lf%ld) ) e(51);
- if ( (la%(lb<<0) + ((lb<<3)>>3)%(la/la)) ) e(52);
- if ( ! ( la++ == lb++ ) ) e(53);
- if ( la != lb ) e(54);
- if ( la++ != (lb++) ) e(55);
- la = 1;
- lb = la + 1;
- if ( -la != -la ) e(56);
- if ( la != --lb ) e(57);
- if ( (((((la))))) != -(-(-(-(la)))) ) e(59);
- if ( lb != 1 ) e(60);
- la = 40000;
- lb = 80000;
- lc = 800000L;
- ld = -800000L;
- lf = 1200000L;
- if ( lc != -ld ) e(61);
- if ( 10 * la != 400000L ) e(62);
- if ( 2 * la != lb ) e(63);
- if ( -(-(-(-(la)))) != la ) e(64);
- if ( 10 * lb != lc ) e(65);
- if ( lf + lf != 2 * lf ) e(66);
- if ( lf - lf ) e(67);
- if ( lc / lc != 1 ) e(68);
- if ( lc / lb != 10 ) e(69);
- if ( lf / la != 30 ) e(70);
- if ( la + lb != lf / 10 ) e(71);
- if ( la - 40000 - 1 != lc - 800001L ) e(72);
- if ( la + la + la + la +la + la != lb + lb + lb ) e(73);
- if ( la > lb ) e(74);
- if ( lb > lc ) e(75);
- if ( lf < ld ) e(76);
- if ( (lf<1000000L) || (((lc-lb-lb*10)>0)) ) e(77);
- if ( lf / 01 != lf ) e(78);
- if ( lf * 01 != lf ) e(79);
- if ( lf + 'a' != lf + 'b' -1 ) e(80);
- if ( (lf % 'a') % 'a' != lf % 'a' ) e(81);
- if ( lf % lf ) e(82);
- if ( lb % la ) e(83);
- if ( (lf<<1) != lf * 2 ) e(84);
- if ( ! ( ( --lf % la ) + 1 ) ) e(86);
- if ( ( lb >> 1 ) ^ la ) e(87);
- la = 1;
- if ( la != 1 ) e(89);
- la <<= 20;
- lb = 2;
- if ( (lb<<19) != la ) e(90);
- la = lb = lc= ld = lf = -345678L;
- if ( (la != lb) || (lb != lc) || (ld != lf) ) e(91);
- if ( (la != lb) || (lb != lc) || (lc != ld) || (ld != lf) ) e(92);
- if ( la != -345678L ) e(93);
- la = 1 | 2;
- la <<= 20;
- lb = la & la & la & la & la | la | la | la;
- if ( la != lb ) e(94);
- if ( ! ( la & lb ) ) e(95);
- if ( la ^ lb ) e(96);
- if ( ! (la | lb) ) e(97);
- if ( (la >> 20) != 3 ) e(98);
- la = 20000;
- la *= 2;
- if ( la < 0 ) e(99);
- if ( 1 * la != la ) e(100);
- lb = 20000;
- if ( (lb<<1) != la ) e(101);
- if ( (5*lb)/10 != lb/2 ) e(102);
- if ( 4*lb != 1*01*2*2*lb ) e(103);
- la = lb = 30000;
- if ( la != la * lb / 30000 ) e(104);
- if ( ++la != ++lb ) e(105);
- lc = 5;
- ld = 150000L;
- if ( lc * (la-1) != ld ) e(106);
-}
-
-
-
-test6() /* global records */
-{
-#ifndef NOFLOAT
- double epsd;
- float epsf;
- double fabs();
-#endif
-
- t = 6;
- tct++;
-#ifndef NOFLOAT
- epsd = EPSD;
- epsf = EPSF;
-#endif
- r1.c1 = 'x';
- r1.i = 40;
- r1.j = 50;
-#ifndef NOFLOAT
- r1.aaa = 3.0;
- r1.bbb = 4.0;
-#endif
- r2.c1 = r1.c1;
- r2.i = 50;
- r2.j = 40;
-#ifndef NOFLOAT
- r2.aaa = 4.0;
- r2.bbb = 5.0;
-#endif
- if ( r1.c1 != 'x' || r1.i != 40 ) e(1);
-#ifndef NOFLOAT
- if ( r1.aaa != 3.0 ) e(1);
-#endif
- if ( r1.i != 40 || r2.i != 50 ) e(2);
- if ( r2.j != 40 || r1.j != 50 ) e(3);
- if ( (r1.c1 + r2.c1)/2 != 'x' ) e(4);
-#ifndef NOFLOAT
- if ( r1.aaa * r1.aaa + r2.aaa * r2.aaa != r2.bbb * r2.bbb ) e(5);
- r1.i = r1.j = r2.i = r2.j = 3.0;
-#else
- r1.i = r1.j = r2.i = r2.j = 3;
-#endif
- if ( r1.i != 3 ) e(6);
- if ( r1.i * r2.j - 9 ) e(7);
- r1.i++;
- if ( r1.i != 4 ) e(8);
- if ( --r1.i != 3 ) e(9);
- if ( (++r2.i) * (--r2.j) != 8 ) e(10);
- if ( (r2.i = r2.j = r1.j = r1.i = -5 ) != -5 ) e(11);
- if ( r2.i * r1.j / 25 != 1 ) e(12);
- r1.c1 = '\0';
- if ( r1.i * r1.j * r2.i * r1.c1 * r2.j ) e(13);
- r2.c1 = 'j';
- if ( r1.c1 + r2.c1 != 'j' ) e(14);
- if ( r1.c1 * r2.c1 ) e(15);
- r2.j = r1.i = r2.i = r1.j = 1;
- if ( (r1.i<<0) != r1.j ) e(16);
- if ( (r1.i >> -0 ) != ( r1.j >> 0 ) ) e(17);
- if ( (r1.i<<1) != 2 ) e(18);
- if ( (r1.i<<2) != 4 ) e(19);
- if ( (r1.j<<3) != (r2.j<<3) ) e(20);
- if ( (r1.i | r1.i | r1.i | r1.i | r1.i) != r1.i ) e(21);
- if ( (r2.j & r1.j & r2.j & r2.i) != (r1.i<<3>>3) ) e(22);
- r1.j = 1;
-#ifndef NOFLOAT
- r1.aaa = 2.0;
- if ( fabs ( r1.j * r1.aaa - 2.0 ) > epsd ) e(23);
- if ( (r1.j << 4) * r1.aaa != (r1.j << 4) * r1.aaa ) e(24);
- if ( ((r1.j<<6)&r1.j) * r1.aaa ) e(25);
- if ((r1.j | (r1.j << 1)) * r1.aaa != ((r1.j << 1) ^ r1.j) * r1.aaa) e(26);
-#endif
- r1.i = r1.j = r2.i = r2.j = -2;
- if ( r1.i > 0 || r1.j >= 0 ) e(27);
- if ( r1.i != r2.j ) e(28);
- if ( !!! ((((( r1.i == r2.j ))))) ) e(28);
- if ( -(-(r1.j)) != r2.j ) e(29);
- if ( r1.i % r1.j ) e(30);
- if ( (r1.i % r1.j) % r1.i ) e(31);
- if ( 0 % r2.j ) e(32);
- if ( 03 * r1.i != -6 ) e(33);
-#ifndef NOFLOAT
- r1.aaa = r2.aaa = -4;
- r1.bbb = r2.bbb = 4;
- if ( r1.aaa > -3.5 ) e(34);
- if ( fabs ( r1.aaa - r2.aaa ) > epsf ) e(35);
-#endif
- r1.c1 = '\03';
-#ifndef NOFLOAT
- if ( fabs ( r2.aaa * r1.aaa - r1.c1 * 5 - 1.0 ) > epsf ) e(36);
-#else
- if ( 5*r1.c1 != 15 ) e(36) ;
-#endif
-}
-
-
-
-
-test7() /* local records */
-{
-#ifndef NOFLOAT
- double epsd;
- float epsf;
- double fabs();
-#endif
- struct tp2 s1, s2;
-
- t = 7;
- tct++;
-#ifndef NOFLOAT
- epsd = EPSD;
- epsf = EPSF;
-#endif
- s1.c1 = 'x';
- s1.i = 40;
- s1.j = 50;
-#ifndef NOFLOAT
- s1.aaa = 3.0;
- s1.bbb = 4.0;
-#endif
- s2.c1 = s1.c1;
- s2.i = 50;
- s2.j = 40;
-#ifndef NOFLOAT
- s2.aaa = 4.0;
- s2.bbb = 5.0;
-#endif
- if ( s1.c1 != 'x' || s1.i != 40 ) e(1);
-#ifndef NOFLOAT
- if ( s1.aaa != 3.0 ) e(1);
-#endif
- if ( s1.i != 40 || s2.i != 50 ) e(2);
- if ( s2.j != 40 || s1.j != 50 ) e(3);
- if ( (s1.c1 + s2.c1)/2 != 'x' ) e(4);
-#ifndef NOFLOAT
- if ( s1.aaa * s1.aaa + s2.aaa * s2.aaa != s2.bbb * s2.bbb ) e(5);
- s1.i = s1.j = s2.i = s2.j = 3.0;
-#else
- s1.i = s1.j = s2.i = s2.j = 3;
-#endif
- if ( s1.i != 3 ) e(6);
- if ( s1.i * s2.j - 9 ) e(7);
- s1.i++;
- if ( s1.i != 4 ) e(8);
- if ( --s1.i != 3 ) e(9);
- if ( (++s2.i) * (--s2.j) != 8 ) e(10);
- if ( (s2.i = s2.j = s1.j = s1.i = -5 ) != -5 ) e(11);
- if ( s2.i * s1.j / 25 != 1 ) e(12);
- s1.c1 = '\0';
- if ( s1.i * s1.j * s2.i * s1.c1 * s2.j ) e(13);
- s2.c1 = 'j';
- if ( s1.c1 + s2.c1 != 'j' ) e(14);
- if ( s1.c1 * s2.c1 ) e(15);
- s2.j = s1.i = s2.i = s1.j = 1;
- if ( (s1.i<<0) != s1.j ) e(16);
- if ( (s1.i >> -0 ) != ( s1.j >> 0 ) ) e(17);
- if ( (s1.i<<1) != 2 ) e(18);
- if ( (s1.i<<2) != 4 ) e(19);
- if ( (s1.j<<3) != (s2.j<<3) ) e(20);
- if ( (s1.i | s1.i | s1.i | s1.i | s1.i) != s1.i ) e(21);
- if ( (s2.j & s1.j & s2.j & s2.i) != (s1.i<<3>>3) ) e(22);
- s1.j = 1;
-#ifndef NOFLOAT
- s1.aaa = 2.0;
- if ( fabs ( s1.j * s1.aaa - 2.0 ) > epsd ) e(23);
- if ( (s1.j << 4) * s1.aaa != (s1.j << 4) * s1.aaa ) e(24);
- if ( ((s1.j<<6)&s1.j) * s1.aaa ) e(25);
- if ((s1.j | (s1.j << 1)) * s1.aaa != ((s1.j << 1) ^ s1.j) * s1.aaa) e(26);
-#endif
- s1.i = s1.j = s2.i = s2.j = -2;
- if ( s1.i > 0 || s1.j >= 0 ) e(27);
- if ( s1.i != s2.j ) e(28);
- if ( !!! ((((( s1.i == s2.j ))))) ) e(28);
- if ( -(-(s1.j)) != s2.j ) e(29);
- if ( s1.i % s1.j ) e(30);
- if ( (s1.i % s1.j) % s1.i ) e(31);
- if ( 0 % s2.j ) e(32);
- if ( 03 * s1.i != -6 ) e(33);
-#ifndef NOFLOAT
- s1.aaa = s2.aaa = -4;
- s1.bbb = s2.bbb = 4;
- if ( s1.aaa > -3.5 ) e(34);
- if ( fabs ( s1.aaa - s2.aaa ) > epsf ) e(35);
-#endif
- s1.c1 = '\03';
-#ifndef NOFLOAT
- if ( fabs ( s2.aaa * s1.aaa - s1.c1 * 5 - 1.0 ) > epsf ) e(36);
-#else
- if ( 5*s1.c1 != 15 ) e(36) ;
-#endif
-}
-
-
-
-
-test8() /* global arrays */
-{
-#ifndef NOFLOAT
- float epsf;
- double epsd;
- double fabs();
-#endif
-
- t = 8;
- tct++;
-#ifndef NOFLOAT
- epsf = EPSF;
- epsd = EPSD;
-#endif
- for ( i=0; i<20 ; i++ )
- a1[i] = i*i;
- if ( a1[9] != 81 || a1[17] != 289 || a1[0] != 0 ) e(1);
- if ( a1[1] + a1[2] + a1[3] != 14 ) e(2);
- if ( ! a1[15] ) e(3);
- if ( a1[8] / a1[4] != 4 ) e(4);
-#ifndef NOFLOAT
- for ( i=0; i<20; i++ )
- a2[i] = 10.0e-1 + i/54.324e-1;
- if ( fabs(a2[4]*a2[4]-a2[4]*(10.0e-1 + 4/54.324e-1 ) ) > epsf ) e(5);
- if ( fabs(a2[8]/a2[8]*a2[9]/a2[9]-a2[10]+a2[10]-1.0 ) > epsf ) e(6);
- if ( fabs(a2[5]-a2[4]-1/54.324e-1 ) > epsf ) e(7);
- for ( i=0; i<20; i++)
- a3[i]= 10.0e-1 + i/54.324e-1;
- if ( fabs(a3[4]*a3[4]-a3[4]*(1.0e0+4/54.324e-1 )) > epsd ) e(8);
- if ( fabs( a3[8]*a3[9]/a3[8]/a3[9]-a3[10]+a3[10]-1000e-3) > epsd ) e(9);
- if ( fabs(a3[8]+a3[6]-2*a3[7]) > epsd ) e(10);
-#endif
- for ( i=0; i<20; i++ )
- a1[i] = i+1;
- if ( a1[a1[a1[a1[a1[a1[0]]]]]] != 6 ) e(11);
- if ( a1[a1[0]+a1[1]+a1[2]+a1[3]] != 11 ) e(12);
- if ( (a1[0] << 2) != 4 ) e(13);
- if ( (a1[0] >> 2) ) e(14);
- if ( (a1[0] << 3 >> 3) != a1[0] ) e(15);
- if ( a1[a1[0] << 1] != 3 ) e(16);
- if ( a1[4<<1] != 9 ) e(17);
- if ( a1[4 << 1] != 9 ) e(18);
- if ( (1 << a1[0]) != 2 ) e(19);
- if ( (1 & a1[0]) != 1 ) e(20);
- if ( a1[4]++ != 5 ) e(21);
- if ( a1[4] != 6 ) e(22);
- if ( --a1[4] != 5 ) e(23);
- if ( a1[ --a1[10] ] != 10 ) e(24);
- a1[0] = 0;
- a1[1] = 1;
- a1[2] = 2;
- a1[3] = 3;
- i = 3;
- if ( a1[--i] != 2 ) e(25);
- if ( a1[ a1[--i] ] != 1 ) e(26);
- if ( a1[a1[a1[a1[a1[a1[a1[a1[3]]]]]]]] != 3 ) e(27);
- if ( a1[1+2] != 3 ) e(28);
- if ( a1[1+2] != a1[3/3] + 2 ) e(29);
- if ( a1[i=2] != 2 ) e(30);
- if ( -a1[i==3] ) e(31);
- if ( a1[3*2 + a1[0]*6 - 10/2 -4 + 3/1] != 0 ) e(32);
- if ( a1['a' + 'c' -2*'b'] ) e(33);
- if ( a1[ a1[0]==a1[1] ] ) e(34);
- if ( a1[a1[1<<1]>>1] != 1 ) e(35);
- a1[i=j=4] = 10;
- if ( (i!=4) || (j!=4) || (i!=j) ) e(36);
- if ( a1[4] != 10 ) e(37);
- if ( a1[--i] != 3 ) e(38);
- if ( a1[i++] != 3 ) e(39);
- if ( --a1[--i] != 2 ) e(40);
- a1[a1[a1[a1[a1[0]=7]=5]=8]=2]=0;
- if ( a1[0] != 7) e(41);
- if ((a1[7] != 5) || (a1[5]!=8) || (a1[8]!=2))e(42);
- if (a1[2]) e(43);
- for ( i=0 ; i<20; i++)
- a1[i] = i;
- a1[0] = 0;
- a1[1] = 01;
- a1[2] = 02;
- a1[3] = 04;
- a1[4] = 010;
- if ((a1[0] | a1[1] | a1[2] | a1[3] | a1[4]) != 017 ) e(44);
- if ( a1[0]<<4 ) e(45);
- if ( (a1[4]>>3) != 1 ) e(46);
- a1[4] = 04;
- a1[010] = 010;
- if ( a1[8] != 8 ) e(47);
- if ( a1[0|1|2|4|8] != (a1[0]|a1[1]|a1[2]|a1[4]|a1[8]) ) e(48);
- if ( a1[a1[0]|a1[1]|a1[2]|a1[4]|a1[8]] != a1[017] ) e(49);
- if ( a1[a1[1]^a1[2]^a1[4]^a1[8]] != a1[a1[1]|a1[2]|a1[4]|a1[8]] ) e(50);
- for ( i = 0; i<20; i++ )
- a1[i] = i+1;
-#ifndef NOFLOAT
- for ( i = 0; i<20; i++ )
- a2[i] = a3[i] = a1[i];
- if ( a2[5] != 6.0 ) e(51);
- if ( a2[13] != 14.0 ) e(52);
- if ( a2[a1[a1[a1[a1[a1[0]]]]]] != 6.0 ) e(53);
-#endif
- if ( a1[12] != 13 ) e(54);
-#ifndef NOFLOAT
- if ( a1[ a1[12] = a2[a1[11]] ] != 14 ) e(55);
- if ( fabs( a2[13] - a2[a1[12]] ) > epsf ) e(56);
- if ( a2[8] != a1[8] ) e(57);
-#endif
-}
-
-
-
-
-test9() /* local arrays */
-{
-#ifndef NOFLOAT
- float epsf;
- double epsd;
- double fabs();
-#endif
- int b1[20];
-#ifndef NOFLOAT
- float b2[20];
- double b3[20];
-#endif
-
- t = 9;
- tct++;
-#ifndef NOFLOAT
- epsf = EPSF;
- epsd = EPSD;
-#endif
- for ( i=0; i<20 ; i++ )
- b1[i] = i*i;
- if ( b1[9] != 81 || b1[17] != 289 || b1[0] != 0 ) e(1);
- if ( b1[1] + b1[2] + b1[3] != 14 ) e(2);
- if ( ! b1[15] ) e(3);
- if ( b1[8] / b1[4] != 4 ) e(4);
-#ifndef NOFLOAT
- for ( i=0; i<20; i++ )
- b2[i] = 10.0e-1 + i/54.324e-1;
- if ( fabs(b2[4]*b2[4]-b2[4]*(10.0e-1 + 4/54.324e-1 ) ) > epsf ) e(5);
- if ( fabs(b2[8]/b2[8]*b2[9]/b2[9]-b2[10]+b2[10]-1.0 ) > epsf ) e(6);
- if ( fabs(b2[5]-b2[4]-1/54.324e-1 ) > epsf ) e(7);
- for ( i=0; i<20; i++)
- b3[i]= 10.0e-1 + i/54.324e-1;
- if ( fabs(b3[4]*b3[4]-b3[4]*(1.0e0+4/54.324e-1 )) > epsd ) e(8);
- if ( fabs( b3[8]*b3[9]/b3[8]/b3[9]-b3[10]+b3[10]-1000e-3) > epsd ) e(9);
- if ( fabs(b3[8]+b3[6]-2*b3[7]) > epsd ) e(10);
-#endif
- for ( i=0; i<20; i++ )
- b1[i] = i+1;
- if ( b1[b1[b1[b1[b1[b1[0]]]]]] != 6 ) e(11);
- if ( b1[b1[0]+b1[1]+b1[2]+b1[3]] != 11 ) e(12);
- if ( (b1[0] << 2) != 4 ) e(13);
- if ( (b1[0] >> 2) ) e(14);
- if ( (b1[0] << 3 >> 3) != b1[0] ) e(15);
- if ( b1[b1[0] << 1] != 3 ) e(16);
- if ( b1[4<<1] != 9 ) e(17);
- if ( b1[4 << 1] != 9 ) e(18);
- if ( (1 << b1[0]) != 2 ) e(19);
- if ( (1 & b1[0]) != 1 ) e(20);
- if ( b1[4]++ != 5 ) e(21);
- if ( b1[4] != 6 ) e(22);
- if ( --b1[4] != 5 ) e(23);
- if ( b1[ --b1[10] ] != 10 ) e(24);
- b1[0] = 0;
- b1[1] = 1;
- b1[2] = 2;
- b1[3] = 3;
- i = 3;
- if ( b1[--i] != 2 ) e(25);
- if ( b1[ b1[--i] ] != 1 ) e(26);
- if ( b1[b1[b1[b1[b1[b1[b1[b1[3]]]]]]]] != 3 ) e(27);
- if ( b1[1+2] != 3 ) e(28);
- if ( b1[1+2] != b1[3/3] + 2 ) e(29);
- if ( b1[i=2] != 2 ) e(30);
- if ( -b1[i==3] ) e(31);
- if ( b1[3*2 + b1[0]*6 - 10/2 -4 + 3/1] != 0 ) e(32);
- if ( b1['a' + 'c' -2*'b'] ) e(33);
- if ( b1[ b1[0]==b1[1] ] ) e(34);
- if ( b1[b1[1<<1]>>1] != 1 ) e(35);
- b1[i=j=4] = 10;
- if ( (i!=4) || (j!=4) || (i!=j) ) e(36);
- if ( b1[4] != 10 ) e(37);
- if ( b1[--i] != 3 ) e(38);
- if ( b1[i++] != 3 ) e(39);
- if ( --b1[--i] != 2 ) e(40);
- b1[b1[b1[b1[b1[0]=7]=5]=8]=2]=0;
- if ( b1[0] != 7) e(41);
- if ((b1[7] != 5) || (b1[5]!=8) || (b1[8]!=2))e(42);
- if (b1[2]) e(43);
- for ( i=0 ; i<20; i++)
- b1[i] = i;
- b1[0] = 0;
- b1[1] = 01;
- b1[2] = 02;
- b1[3] = 04;
- b1[4] = 010;
- if ((b1[0] | b1[1] | b1[2] | b1[3] | b1[4]) != 017 ) e(44);
- if ( b1[0]<<4 ) e(45);
- if ( (b1[4]>>3) != 1 ) e(46);
- b1[4] = 04;
- b1[010] = 010;
- if ( b1[8] != 8 ) e(47);
- if ( b1[0|1|2|4|8] != (b1[0]|b1[1]|b1[2]|b1[4]|b1[8]) ) e(48);
- if ( b1[b1[0]|b1[1]|b1[2]|b1[4]|b1[8]] != b1[017] ) e(49);
- if ( b1[b1[1]^b1[2]^b1[4]^b1[8]] != b1[b1[1]|b1[2]|b1[4]|b1[8]] ) e(50);
- for ( i = 0; i<20; i++ )
- b1[i] = i+1;
-#ifndef NOFLOAT
- for ( i = 0; i<20; i++ )
- b2[i] = b3[i] = b1[i];
- if ( b2[5] != 6.0 ) e(51);
- if ( b2[13] != 14.0 ) e(52);
- if ( b2[b1[b1[b1[b1[b1[0]]]]]] != 6.0 ) e(53);
-#endif
- if ( b1[12] != 13 ) e(54);
-#ifndef NOFLOAT
- if ( b1[ b1[12] = b2[b1[11]] ] != 14 ) e(55);
- if ( fabs( b2[13] - b2[b1[12]] ) > epsf ) e(56);
- if ( b2[8] != b1[8] ) e(57);
-#endif
-}
-
-
-
-
-test10() /* global pointers */
-{
-#ifndef NOFLOAT
- float epsf;
- double fabs();
-#endif
- int li;
- struct tp2 strp2;
-
-#ifndef NOFLOAT
- epsf = EPSF;
-#endif
- t = 10;
- tct++;
- p1 = &li;
- li = 076;
- if ( p1 != &li ) e(1);
- p11 = &li;
- if ( p1 != p11 ) e(3);
- if ( *p1 != *p11 ) e(4);
- if ( &li != p11 ) e(5);
- if ( *&p1 != p1 ) e(6);
- if ( &*p1 != p1 ) e(7);
- if ( **&p1 != *&*p1 ) e(10);
- if ( *&*&*&*&*&li != li ) e(11);
- p1 = &p ;
- p2 = &p1;
- *p1 = **p2 = 34;
- if ( p1 != *p2 ) e(25);
- li = 4;
- p1 = &li;
- p2 = &p1;
- p3 = &p2;
- p4 = &p3;
- p5 = &p4;
- if ( *p1 != **p2 ) e(26);
- if ( **p2 != **p2 ) e(27);
- if ( ***p3 != **p2 ) e(28);
- if ( *****p5 != 4 ) e(30);
- li = 3;
- if ( *p1 - *p1 ) e(44);
- if ( p1 != &li ) e(46);
- pp1 = (struct tp2 *) alloc( sizeof *pp1 );
- pp2 = (struct tp2 *) alloc( sizeof *pp2 );
- pp3 = (struct tp2 *) alloc( sizeof *pp3 );
- pp1->i = 1325;
- if ( pp1->i != 1325 ) e(47);
- pp1->i = pp2->i = pp3->i = 3;
- if ( pp1->i * pp1->i != 9 ) e(48);
- if ( pp1->i * pp2->i * pp3->i != pp2->i * 3 * 3 ) e(49);
- if ( pp1->i - pp3->i ) e(50);
- if ( (*pp1).i != pp1->i ) e(51);
- pp1->i++;
- if ( ++pp2->i != pp1->i ) e(52);
- if ( pp2->i != 4 ) e(53);
-#ifndef NOFLOAT
- pp1->aaa = 3.0;
- pp2->aaa = -3.0;
- pp3->bbb = 25.0;
- if ( pp1->aaa != 3.0 ) e(54);
- if ( fabs( pp1->aaa + pp2->aaa ) > epsf ) e(55);
- if ( fabs( pp1->aaa * pp2->aaa + pp3->bbb - 16 ) > epsf ) e(56);
- if ( fabs( pp1->aaa / pp2->aaa + 1 ) > epsf ) e(57);
-#endif
- pp1->c1 = 'x';
- pp1->i = pp1->j = 45;
-#ifndef NOFLOAT
- pp1->aaa = 100.0;
- pp1->bbb = 1024.0;
-#endif
- strp2.c1 = pp1->c1; /* strp2 is a local struct */
- strp2.i = pp1->i = strp2.j = pp1->j;
-#ifndef NOFLOAT
- strp2.aaa = pp1->aaa;
- strp2.bbb = pp1->bbb;
-#endif
- if ( strp2.c1 != 'x' ) e(58);
- if ( strp2.i != strp2.j ) e(59);
-#ifndef NOFLOAT
- if ( strp2.aaa != pp1->aaa ) e(60);
- if ( strp2.bbb != pp1->bbb ) e(61);
-#endif
-}
-
-#ifndef NOFLOAT
-
-test11() /* real arithmetic */
-{
- double fabs();
- double epsd;
- float epsf;
- float locxf;
-
- t = 11 ;
- tct++;
- epsf = EPSF;
- epsd = EPSD;
- xf = 1.50;
- yf = 3.00;
- zf = 0.10;
- xd = 1.50;
- yd = 3.00;
- zd = 0.10;
- if ( fabs(1.0 + 1.0 - 2.0) > epsd ) e(1);
- if ( fabs( 1e10-1e10 ) > epsd ) e(2);
- if ( fabs( 1.0e+5 * 1.0e+5 - 100e+8 ) > epsd ) e(3);
- if ( fabs( 10.0/3.0 * 3.0/10.0 - 100e-2 ) > epsd ) e(4);
- if ( 0.0e0 != 0 ) e(5);
- if ( fabs( 32767.0 - 32767 ) > epsd ) e(6);
- if ( fabs( 1.0+2+5+3.0e0+7.5e+1+140e-1-100.0 ) > epsd ) e(7);
- if ( fabs(-1+(-1)+(-1.0)+(-1.0e0)+(-1.0e-0)+(-1e0)+6 ) > epsd ) e(8);
- if ( fabs(5.0*yf*zf-xf) > epsf ) e(9);
- if ( fabs(5.0*yd*zd-xd) > epsd ) e(10);
- if ( fabs(yd*yd - (2.0*xd)*(2.0*xd) ) > epsd ) e(11);
- if ( fabs(yf*yf - (2.0*xf)*(2.0*xf) ) > epsf ) e(12);
- if ( fabs( yd*yd+zd*zd+2.0*yd*zd-(yd+zd)*(zd+yd) ) > epsf ) e(13);
- if ( fabs( yf*yf+zf*zf+2.0*yf*zf-(yf+zf)*(zf+yf) ) > epsf ) e(14);
- xf = 1.10;
- yf = 1.20;
- if ( yd<xd ) e(15);
- if ( yd<=xd ) e(16);
- if ( yd==xd ) e(17);
- if ( xd>=yd ) e(18);
- if ( yd<xd ) e(19);
- if ( fabs(yd-xd-1.5) > epsd ) e(20);
- if ( 1.0 * 3.0 != 3.0 * 1.0 ) e(21);
- if ( 1.0 != 1e+0 ) e(22);
- if ( 4.5 < 4.4 ) e(23);
- if ( -3.4 != -3.4 ) e(24);
- if ( 10/3.0 - 10/3.0 != 0.0 ) e(25);
- if ( fabs( (1<<0) * (-5.3) + 5.3 ) > epsd ) e(26);
- if ( fabs( (1<<3) * 5.0 - 4e+1 ) > epsd ) e(27);
- if ( fabs( ((1<<5)>>5) - 1e-0 ) > epsd ) e(28);
- if ( fabs ( 00000 * 3.0 ) > epsd ) e(29);
- if ( fabs ( 8 * 5.0 - 02 * 02 + 04 / 1.0 -40.0 ) > epsd ) e(30);
- if ( fabs ( 'a' / 1.0 - 'a' ) > epsd ) e(31);
- if ( fabs ( (!1) * ( 2.0 / -34e-1 ) ) > epsd ) e(32);
- if ( fabs ( (01 | 1 | 2) * 4.0 - 12.0 ) > epsd ) e(33);
- if ( fabs ( 1.0 * 2.0 * 3.0 * 4.0 * 5.0 - 120.0 ) > epsd ) e(34);
- if ( fabs ( 1.0 * 2.0 * (1 | (4>>1)) - 6 ) > epsd ) e(35);
- if ( fabs ( ( 0 ^ 0 ^ 0 ^ 0 ) * 0.0 ) > epsd ) e(36);
- if ( fabs ( 1.0 * 2.0 * (1 ^ (4>>1)) - 6 ) > epsd ) e(37);
- if ( fabs ( (((((-1.0 * (((((-1.0))))) - 1.0 ))))) ) > epsd) e(38);
- if ( fabs ( ( 2==3 ) * 3.0 ) > epsd ) e(39);
- if ( ( 4 + 3 > 5 ? 3.4 : -5e+3 ) != 3.4 ) e(40);
- if ( ( -4 -'a' > 0 ? 3.4 : -5e+3 ) != -5e+3 ) e(41);
- locxf = 3.0;
- xf = 3.0;
- if ( locxf != locxf ) e(42);
- if ( locxf != xf ) e(43);
- if ( locxf * xf != xf * locxf ) e(44);
- if ( fabs ( ((2*3)>>1) / 3.0 - 1.0 ) > epsd ) e(45);
- if ( fabs ( 'a' / locxf - 'a' / xf ) > epsd ) e(46);
- if ( fabs( xf * locxf - 9.0 ) > epsd ) e(47);
- yd = 3.0;
- if ( fabs( xf*yd - 9.0) > epsd ) e(48);
- if ( yd >= 4 ) e(49);
- if ( locxf == 2 ) e(50);
-}
-
-#endif
+++ /dev/null
-/*
- * (c) copyright 1987 by the Vrije Universiteit, Amsterdam, The Netherlands.
- * See the copyright notice in the ACK home directory, in the file "Copyright".
- *
- */
-#include <math.h>
-#include <stdio.h>
-
-char rcs_id[] = "$Id$" ;
-
-/* This program can be used to test C-compilers */
-
-int i,j,k,l,m,ect,pct,t,*p1;
-int a1[20];
-#ifndef NOFLOAT
-float a2[20],xf,yf,zf;
-double a3[20],xd,yd,zd;
-#endif
-
-char alstr[3000] ;
-char *alptr = alstr ;
-
-struct tp2
-{ char c1;
- int i,j;
-#ifndef NOFLOAT
- float aaa;
- double bbb;
-#endif
-} r1,r2,*p3;
-
-struct node
-{ int val;
- struct node *next;
-} *head,*tail,*p2;
-
-main()
-{ ect = 0; pct = 0;
- test1();test2();test3();
- test4();test5();
- test6();test7();test8();
- test9();test10();
-#ifndef NOFLOAT
- test11();
-#endif
- printf("program test1\n");
- printf("%d tests completed. Number of errors = %d\n",pct,ect);
- return 0 ;
-}
-
-char *alloc(size) {
- register char *retval ;
-
- retval=alptr ;
- alptr += size ;
- if ( alptr-alstr>sizeof alstr ) {
- printf("allocation overflow\n") ;
- exit(8) ;
- }
- return(retval) ;
-}
-
-int abs(a) int a ; { return ( a<0 ? -a : a) ; }
-#ifndef NOFLOAT
-double fabs(a) double a ; { return( a<0 ? -a : a) ; }
-#endif
-
-e(n)
-{ ect++; printf("error %d in test %d \n",n,t);
-}
-
-inc(n)
-{ return(++n);}
-
-/***********************************************************************/
-
-test1()
-/*arithmetic on constants */
-{ t = 1; pct++;
- if (1+1 != 2) e(1);
- if (3333 + 258 != 3591) e(2);
- if (3*4 != 12) e(3);
- if (111*111 != 12321) e(4);
- if (50 / 5 != 10) e(5);
- if (7498 / 75 != 99) e(6);
- if (456 - 345 != 111) e(7);
- if (1+(-2) != -1) e(8);
- if (-3 * -4 != 12) e(9);
- if (-2 / 2 != -1) e(10);
- if (-5 / 1 != -5 ) e(11);
- if (-4 - -5 != 1) e(12);
- if ( 03 + 02 != 05) e(13);
- if ( 03456 + 88 != 03606 ) e(14);
- if ( 0100 * 23 != 02700 ) e(15);
- if ( 045 / 020 != 2) e(16);
- if (0472 - 0377 != 073 ) e(17);
- if ('a' + 3 != 100) e(18);
- if ('a' + 'c' != 'b' + 'b') e(19);
- if ( 'z' * 'z' != 14884 ) e(20);
- if ( -'z' / 01 != -'z' ) e(21);
- if ( 077777 >> 3 != 07777 ) e(22);
- if ( 077777 >> 15 ) e(23);
- if ( 234 << 6 != 234 << 6 ) e(24);
- if ( 0124 & 07765 != 0124 ) e(25);
- if ( 34 & 31 != 2 ) e(26);
- if ( ( -4 | 3 ) != -1 ) e(27);
- if ( ( 5 | 013 | 020 ) != 31 ) e(28);
- if ( ( -7 ^ 3 ) != -6 ) e(29);
- if ( ( 07373 ^ 4632 ) != 016343 ) e(30);
- if ( (1+2+3)*(2+3+4)*(3+5+5) / 2 != ((3*((5+3+2)*10)+51)*6)/6 ) e(31);
- if ( (1000*2+5*7+13)/ 8 != 2*2*2*2*4*4 ) e(32);
- if ((1*2*3*4*5*6*7 / 5040 !=
- 5040 / 7 / 6 / 5 / 4 / 3 / 2 / 1 )) e(33);
- if ( -(-(-(-(-(-(1)))))) != 1 ) e(34);
- if (- 1 != -((((((((((1)))))))))) ) e(35);
- if ( -1-1-1-1-1-1 != -6-3+3 ) e(36);
- if ( -4 * -5 != 20 ) e(37);
- if ( 2<1 ) e(38);
- if ( 2<= 1 ) e(39);
- if ( 2==3 ) e(40);
- if ( 2 != 2 ) e(41);
- if ( 2 >= 3) e(42);
- if ( 2 > 3 ) e(43);
- if (2 + 0 != 2 ) e(44);
- if (2 - 0 != 2 ) e(45);
- if (2 * 0 != 0 ) e(46);
- if ( 0 / 1 != 0 ) e(47);
- if ( -0 != 0 ) e(48);
- if ( 0 * 0 != 0 ) e(49);
- if ( 32767 > 32767 ) e(50);
- if ( 0456 < 0400 ) e(51);
- if ( 0456 != ( 0400 | 050 | 06 ) ) e(52);
- if ( 2*2<<2*2/4 != 010 ) e(53);
- if ( 0 || 0 ) e(54);
- if ( 1 && 0 ) e(55);
- if ( ( 123 ? 123 * 4 :345) != 492 ) e(56);
- if ( ( 0 ? 345 : 280) != 280 ) e(57);
- if ( ( (2*2/2<<2)|(2/2) ) != 9 ) e(58);
- if ( !( 111 || 23 && 0 ) ) e(59);
- if ( !1 ) e(60);
- if ( !0 == 0 ) e(61);
- if ( !!!!!!!!0 ) e(62);
-}
-
-/***********************************************************************/
-
-test2()
-/*arithmetic on global integer variables*/
-{ t = 2; pct++;
- i = 1; j = 2; k = 3; l = 4; m = 10;
- if ( i+j != k ) e(1);
- if ( i+k != l ) e(2);
- if ( j-k != -i ) e(3);
- if ( j*(j + k) != m ) e(4);
- if ( -m != -(k+k+l) ) e(5);
- if ( i / i != 1 ) e(6);
- if ( m*m / m != m ) e(7);
- if ( 10 * m != 100 ) e(8);
- if ( m * (-10) != -100 ) e(9);
- if ( j / k != 0 ) e(10);
- if ( 100 / k != 33 ) e(11);
- if ( i+j*k+l+m / j + 50 / k != 32 ) e(12);
- if ( j*k*m / 6 != 10 ) e(13);
- if ( (k>4) || (k>=4) || (k==4) ) e(14);
- if ( (m<j) || (m<=j) || (m==j) ) e(15);
- if ( i+j-k ) e(16);
- if ( j<i ) e(17);
- if ( j != j ) e(18);
- if ( i > j ) e(19);
- if ( (i > j ? k : k*j ) != 6 ) e(20);
- if ( (i < j ? k : k*j ) != 3 ) e(21);
- if ( j<<i != l ) e(22);
- if ( j>> i != i ) e(25);
- if ( i++ != 1 ) e(26);
- if ( --i != 1 ) e(27);
- if ( i-- != 1 ) e(28);
- if ( ( i+j ) && ( i<0 ) || (m-10) && (064) ) e(29);
- if ( ( i+j ) && !(i>=0) || (m-10) && !( 0 ) ) e(30);
-}
-
-/***********************************************************************/
-
-test3()
-/*arithmetic on local integer variables*/
-{ int a,b,c,d,f;
- t = 3; pct++;
- a = 1; b = 2; c = 3; d = 4; f = 10;
- if ( a+b != c ) e(1);
- if ( a+c != d ) e(2);
- if ( b-c != -a ) e(3);
- if ( b*(b + c) != f ) e(4);
- if ( -f != -(c+c+d) ) e(5);
- if ( a / a != 1 ) e(6);
- if ( f*f / f != f ) e(7);
- if ( 10 * f != 100 ) e(8);
- if ( f * (-10) != -100 ) e(9);
- if ( b / c != 0 ) e(10);
- if ( 100 / c != 33 ) e(11);
- if ( a+b*c+d+f / b + 50 / c != 32 ) e(12);
- if ( b*c*f / 6 != 10 ) e(13);
- if ( (c>4) || (c>=4) || (c==4) ) e(14);
- if ( (f<b) || (f<=b) || (f==b) ) e(15);
- if ( c != a+b ) e(16);
- if ( b<a ) e(17);
- if ( b != b ) e(18);
- if ( a > b ) e(19);
- if ( (a > b ? c : c*b ) != 6 ) e(20);
- if ( (a < b ? c : c*b ) != 3 ) e(21);
- if ( b<<a != d ) e(22);
- if ( b>> a != a ) e(25);
- if ( a++ != 1 ) e(26);
- if ( --a != 1 ) e(27);
- if ( a-- != 1 ) e(28);
- if ( ( a+b ) && ( a<0 ) || (f-10) && (064) ) e(29);
- if ( ( a+b ) && !(a>=0) || (f-10) && !( 0 ) ) e(30);
-}
-
-/***********************************************************************/
-
-test4()
-/* global arrays */
-{
-#ifndef NOFLOAT
- float epsf;
- double epsd;
-#endif
- t=4; pct++;
-#ifndef NOFLOAT
- epsf = 1e-7; epsd = 1e-14;
-#endif
- for ( i=0; i<20 ; i++ ) a1[i] = i*i;
- if ( a1[9] != 81 || a1[17] != 289 || a1[0] != 0 ) e(1);
- if ( a1[1] + a1[2] + a1[3] != 14 ) e(2);
- if ( ! a1[15] ) e(3);
- if ( a1[8] / a1[4] != 4 ) e(4);
-#ifndef NOFLOAT
- for ( i=0; i<20; i++ ) a2[i] = 10.0e-1 + i/54.324e-1;
- if ( fabs(a2[4]*a2[4]-a2[4]*(10.0e-1 + 4/54.324e-1 ) ) > epsf ) e(5);
- if ( fabs(a2[8]/a2[8]*a2[9]/a2[9]-a2[10]+a2[10]-1.0 ) > epsf ) e(6);
- if ( fabs(a2[5]-a2[4]-1/54.324e-1 ) > epsf ) e(7);
- for ( i=0; i<20; i++ ) a3[i]= 10.0e-1 + i/54.324e-1;
- if ( fabs(a3[4]*a3[4]-a3[4]*(1.0e0+4/54.324e-1 )) > epsd ) e(8);
- if ( fabs( a3[8]*a3[9]/a3[8]/a3[9]-a3[10]+a3[10]-1000e-3) > epsd ) e(9);
- if ( fabs(a3[8]+a3[6]-2*a3[7]) > epsd ) e(10);
-#endif
-}
-
-/****************************************************************/
-
-test5()
-/* local arrays */
-{ int b1[20];
-#ifndef NOFLOAT
- float epsf, b2[20]; double b3[20],epsd;
- epsf = 1e-7; epsd = 1e-14;
-#endif
- t = 5; pct++;
- for ( i=0; i<20 ; i++ ) b1[i] = i*i;
- if ( b1[9]-b1[8] != 17 ) e(1);
- if ( b1[3] + b1[4] != b1[5] ) e(2);
- if ( b1[1] != 1||b1[3] != 9 || b1[5] != 25 || b1[7] != 49 ) e(3);
- if ( b1[12] / b1[6] != 4 ) e(4);
-#ifndef NOFLOAT
- for ( i=0; i<20; i += 1) b2[i] = 10.0e-1+i/54.324e-1;
- if (fabs(b2[4]*b2[4]-b2[4]*(10.0e-1+4/54.324e-1)) > epsf ) e(5);
- if (fabs(b2[8]/b2[8]*b2[9]/b2[9]-b2[10]+b2[10]-1.0) > epsf ) e(6);
- if ( fabs(b2[5]-b2[4]-1/5.4324 ) > epsf ) e(7);
- for ( i=0; i<20 ; i += 1 ) b3[i] = 10.0e-1+i/54.324e-1;
- if (fabs(b3[4]*b3[4]-b3[4]*(10.0e-1+4/54.324e-1)) > epsd ) e(8);
- if (fabs(b3[8]*b3[9]/b3[8]/b3[9]+b3[10]-b3[10]-1.0) > epsd ) e(9);
- if (fabs(b3[10]+b3[18]-2*b3[14]) > epsd ) e(10);
-#endif
-}
-
-
-/****************************************************************/
-
-
-
-test6()
-/* mixed local and global */
-{ int li,b1[20];
-#ifndef NOFLOAT
- double b3[10],xxd,epsd;
-#endif
- t = 6; pct++;
-#ifndef NOFLOAT
- epsd = 1e-14;
-#endif
- li = 6; i = li ;
- if ( i != 6 ) e(1);
- i = 6; li = i;
- if ( i != li ) e(2);
- if ( i % li ) e(3);
- i=li=i=li=i=li=i=i=i=li=j;
- if ( i != li || i != j ) e(4);
- for ( i=li=0; i<20 ; i=li ) { b1[li]= (li+1)*(i+1) ; li++; }
- if ( b1[9] != a1[10] ) e(5);
- if ( b1[7]/a1[4] != a1[2] ) e(6);
- li = i = 121;
- if ( b1[10] != i && a1[11]!= li ) e(7);
-#ifndef NOFLOAT
- for ( li=0 ; li<10; li++ ) b3[li]= 1.0e0 + li/54.324e-1;
- if ( fabs(b3[9]-a3[9]) > epsd ) e(8);
- if ( fabs(8/54.324e-1 - b3[9]+a3[1] ) > epsd ) e(9);
-#endif
-}
-
-/***************************************************************/
-
-
-test7()
-/*global records */
-{ t=7; pct++;
- r1.c1= 'x';r1.i=40;r1.j=50;
-#ifndef NOFLOAT
- r1.aaa=3.0;r1.bbb=4.0;
-#endif
- r2.c1=r1.c1;
- r2.i= 50;
- r2.j=40;
-#ifndef NOFLOAT
- r2.aaa=4.0;r2.bbb=5.0;
-#endif
- if (r1.c1 != 'x' || r1.i != 40 ) e(1);
-#ifndef NOFLOAT
- if ( r1.aaa != 3.0 ) e(1);
-#endif
- i = 25;j=75;
- if (r1.i != 40 || r2.i != 50 ) e(2);
- if ( r2.j != 40 || r1.j != 50 ) e(3);
- if ( (r1.c1 + r2.c1)/2 != 'x' ) e(4);
-#ifndef NOFLOAT
- if ( r1.aaa*r1.aaa+r2.aaa*r2.aaa != r2.bbb*r2.bbb) e(5);
-#endif
- r1.i = 34; if ( i!=25 ) e(6);
-}
-
-
-/****************************************************************/
-
-
-test8()
-/*local records */
-{ struct tp2 s1,s2;
- t=8; pct++;
- s1.c1= 'x';s1.i=40;s1.j=50;
-#ifndef NOFLOAT
- s1.aaa=3.0;s1.bbb=4.0;
-#endif
- s2.c1=s1.c1;
- s2.i= 50;
- s2.j=40;
-#ifndef NOFLOAT
- s2.aaa=4.0;s2.bbb=5.0;
-#endif
- if (s1.c1 != 'x' || s1.i != 40 ) e(1);
-#ifndef NOFLOAT
- if ( s1.aaa != 3.0 ) e(1);
-#endif
- i = 25;j=75;
- if (s1.i != 40 || s2.i != 50 ) e(2);
- if ( s2.j != 40 || s1.j != 50 ) e(3);
- if ( (s1.c1 + s2.c1)/2 != 'x' ) e(4);
-#ifndef NOFLOAT
- if ( s1.aaa*s1.aaa+s2.aaa*s2.aaa != s2.bbb*s2.bbb) e(5);
-#endif
- s1.i = 34; if ( i!=25 ) e(6);
-}
-
-
-
-/***********************************************************************/
-test9()
-/*global pointers */
-{ t=9; pct++;
- p1=alloc( sizeof *p1 );
- p2=alloc( sizeof *p2);
- p3=alloc(sizeof *p3);
- *p1 = 1066;
- if ( *p1 != 1066 ) e(1);
- p3->i = 1215;
- if ( p3->i != 1215 ) e(2);
- p2->val = 1566;
- if ( p2->val != 1566 || p2->next ) e(3);
- if ( a1 != &a1[0] ) e(4);
- p1 = a1;
- if ( ++p1 != &a1[1] ) e(5);
- head = 0;
- for (i=0;i<=100;i += 1)
- { tail = alloc(sizeof *p2);
- tail->val = 100+i;tail->next = head;
- head = tail;
- }
- if ( tail->val != 200 || tail->next->val != 199 ) e(6);
- if ( tail->next->next->next->next->next->val != 195) e(7);
- tail->next->next->next->next->next->val = 1;
- if ( tail->next->next->next->next->next->val != 1) e(8);
- i = 27;
- if ( *&i != 27 ) e(9);
- if ( &*&*&*&i != &i ) e(10);
- p1 = &i;i++;
- if ( p1 != &i ) e(11);
-}
-
-/*****************************************************************/
-test10()
-/*local pointers */
-{ struct tp2 *pp3;
- struct node *pp2,*ingang,*uitgang;
- int *pp1;
- int b1[20];
- t=10; pct++;
- pp1=alloc( sizeof *pp1 );
- pp2=alloc( sizeof *p2);
- pp3=alloc(sizeof *pp3);
- *pp1 = 1066;
- if ( *pp1 != 1066 ) e(1);
- pp3->i = 1215;
- if ( pp3->i != 1215 ) e(2);
- pp2->val = 1566;
- if ( pp2->val != 1566 || p2->next ) e(3);
- if ( b1 != &b1[0] ) e(4);
- pp1 = b1;
- if ( ++pp1 != &b1[1] ) e(5);
- ingang = 0;
- for (i=0;i<=100;i += 1)
- { uitgang = alloc(sizeof *pp2);
- uitgang->val = 100+i;uitgang->next = ingang;
- ingang = uitgang;
- }
- if ( uitgang->val != 200 || uitgang->next->val != 199 ) e(6);
- if ( uitgang->next->next->next->next->next->val != 195 ) e(7);
- uitgang->next->next->next->next->next->val = 1;
- if ( uitgang->next->next->next->next->next->val != 1) e(8);
-}
-
-/***************************************************************/
-
-#ifndef NOFLOAT
-test11()
-/* real arithmetic */
-{
- double epsd; float epsf;
- t = 11; pct++; epsf = 1e-6; epsd = 1e-14;
- xf = 1.50 ; yf = 3.00 ; zf = 0.10;
- xd = 1.50 ; yd = 3.00 ; zd = 0.10;
- if ( fabs(1.0 + 1.0 - 2.0 ) > epsd ) e(1);
- if ( fabs( 1e10-1e10 ) > epsd ) e(2);
- if ( fabs( 1.0e+5*1.0e+5-100e+8 ) > epsd ) e(3);
- if ( fabs( 10.0/3.0*3.0/10.0-100e-2 ) > epsd ) e(4);
- if ( 0.0e0 != 0 ) e(5);
- if ( fabs( 32767.0 - 32767 ) > epsd ) e(6);
- if ( fabs( 1.0+2+5+3.0e0+7.5e+1+140e-1-100.0 ) > epsd ) e(7);
- if ( fabs(-1+(-1)+(-1.0)+(-1.0e0)+(-1.0e-0)+(-1e0)+6 ) > epsd ) e(8);
- if ( fabs(5.0*yf*zf-xf) > epsf ) e(9);
- if ( fabs(5.0*yd*zd-xd) > epsd ) e(10);
- if ( fabs(yd*yd - (2.0*xd)*(2.0*xd) ) > epsd ) e(11);
- if ( fabs(yf*yf - (2.0*xf)*(2.0*xf) ) > epsf ) e(12);
- if ( fabs( yd*yd+zd*zd+2.0*yd*zd-(yd+zd)*(zd+yd) ) > epsd ) e(13);
- if ( fabs( yf*yf+zf*zf+2.0*yf*zf-(yf+zf)*(zf+yf) ) > epsf ) e(14);
- xf=1.10;yf=1.20;
- if ( yd<xd ) e(15);
- if ( yd<=xd ) e(16);
- if ( yd==xd ) e(17);
- if ( xd>=yd ) e(18);
- if ( yd<xd ) e(19);
- if ( fabs(yd-xd-1.5) > epsd ) e(20);
-}
-#endif
-
-
-/*****************************************************************/
+++ /dev/null
-/*
- * (c) copyright 1987 by the Vrije Universiteit, Amsterdam, The Netherlands.
- * See the copyright notice in the ACK home directory, in the file "Copyright".
- *
- */
-
-char rcs_id[] = "$Id$" ;
-
-/* This program can be used to test C-compilers */
-
-
-int t, ect, tct;
-
-
-/**********************************************************************/
-/*
- * Testing basic function calls
- *
- */
-
-
-
-main()
-{
- tct = 0;
- ect = 0;
- test1();
- test2();
- test3();
- test4();
- test5();
- test6();
- printf("End of test program, %d tests completed, %d errors detected\n",
- tct,ect);
- return 0 ;
-}
-
-
-
-
-e(n)
-int n;
-{
- ect++;
- printf("Error %d in test%d \n",n,t);
-}
-
-
-
-
-one()
-{
- return(1);
-}
-
-
-
-
-two()
-{
- return(2);
-}
-
-
-
-
-three()
-{
- return(3);
-}
-
-
-
-
-four()
-{
- return(4);
-}
-
-
-
-
-five()
-{
- return(5);
-}
-
-
-
-
-plus()
-{
- return ( one() + two() + three() + four() + five() );
-}
-
-
-
-
-multipl()
-{
- return( one() * two() * three() * four() * five() );
-}
-
-
-
-
-subtr()
-{
- return( - one() - two() - three() - four() - five() );
-}
-
-
-
-
-test1()
-{
- int i;
- int count;
-
- t = 1;
- tct++;
- if ( one() != 1 ) e(1);
- if ( two() != 2 ) e(2);
- if ( three() != 3 ) e(3);
- if ( four() != 4 ) e(4);
- if ( five() != 5 ) e(5);
- if ( (one() + two()) != 3 ) e(6);
- if ( ((((((one() + two())))))) != 3) e(7);
- if ( (one() * three()) != 3) e(8);
- if (( (four() + three()) * two()) != 14) e(9);
- if ( (four() + four()) != (two() * four()) ) e(10);
- if ( (four() - four()) / three() ) e(11);
- if (( four() + 3 * 12 - ( one() * two() * 2 ) ) != 36 ) e(12);
- if ( one() & two() & four() & three() ) e(13);
- if ( !( three() && two() ) ) e(14);
- for (i=0; i<8; i++)
- {
- count = one() + two() + three() + four();
- count = count * one();
- count = count * two() - one() - two() - three() - four();
- }
- if (count != 10) e(15);
- if ( !one() ) e(16);
- if ( plus() != 15 ) e(17);
- if ( multipl() != 120 ) e(18);
- if ( subtr() != -15 ) e(19);
- if ( -subtr() != plus() ) e(18);
- if ( -subtr() != plus() ) e(21);
-}
-
-
-
-
-echo(a)
-int a;
-{
- return ( a );
-}
-
-
-
-
-min(a,b)
-int a,b;
-{
- if ( a < b )
- return(a);
- return(b);
-}
-
-
-
-
-max1(a,b)
-int a,b;
-{
- if ( a < b )
- return(b);
- return(a);
-}
-
-
-
-
-max2(a,b)
-int a,b;
-{
- return ( ( a < b ? b : a ) );
-}
-
-
-
-
-test2()
-{
- int i,j;
- int a,b;
-
- t = 2;
- tct++;
- if ( echo(1) != 1 ) e(1);
- if ( echo(3) != 3 ) e(2);
- if ( echo(0) ) e(3);
- if ( echo(2) + echo(3) != echo(5) ) e(4);
- if ( echo( 2 + 3 ) != 5 ) e(5);
- if ( echo ( 1 + 2 + 3 + 4 + 5 ) != 10 + echo(5) ) e(6);
- if (( echo( 2<<1 ) ) != 4 ) e(7);
- if ( echo( 2 >> 1 ) != 1 ) e(8);
- if ( echo( 1 << 4 ) != echo( 2 << 3 ) ) e(9);
- if ( echo( echo(4) ) != echo(4) ) e(10);
- if (( echo ( echo ( echo( echo ( echo ( 3 ) ) ) ) ) ) != 3 ) e(11);
- if ( echo( echo( echo(2+3-4+echo(4)*echo(2))) ) != 9 ) e(12);
- if ( min(1,2) != 1) e(13);
- if (min(0,45) != 0) e(14);
- if (min(45,0) != 0) e(15);
- if (min(-72,-100) != -100) e(16);
- if (min(-100,-72) != -100) e(17);
- if (min(1<<3,2<<3) != (1<<3) ) e(18);
- if ( min( echo(3), echo(3) ) != echo (echo(3)) ) e(19);
- if ( max1('a','b') != 'b' ) e(20);
- if ( max1('b','a') != 'b' ) e(21);
- if ( max1(-3,54+2) != ( -3 < 54+2 ? 54+2 : -3 ) ) e(22);
- if (max1('a'+'b'+34,'a'*2) != max2('a'*2,'a'+'b'+34)) e(23);
- if (max1(345/23,4) != max1( echo(345/23), 4) ) e(24);
- if ( max1( max1(2,3), max1(2,3) ) != max1(2,3) ) e(25);
- for (i=3; i<5; i++)
- if ((max1(i,-i)) != i) e(26);
- for (j=min('a',34); j<max2('a',34); j++)
- {
- if ( j<min(max1('a',34),min('a',34)) ) e(27);
- if ( j>max1(min(34,'a'),max2(34,'a')) ) e(28);
- }
- a=b= -32768;
- if ( min(echo(a),a) != a) e(29);
- if ( max1(echo(b),max1(b,b)) != b) e(30);
-}
-
-
-
-
-sum(k)
-int k;
-{
- if (k<=0)
- return(0);
- return(k+sum(k-1));
-}
-
-
-
-
-formula(k)
-int k;
-{
- if (k<=0)
- return(0);
- return ( ((((( (k*(k+1))/2 ))))) );
-}
-
-
-
-
-test3()
-{
- int k;
- int count;
-
- t = 3;
- tct++;
- count=0;
- if ( sum(-4) != 0 ) e(1);
- if ( sum(0) != 0 ) e(2);
- if ( sum(2) != 3 ) e(3);
- if ( sum(10) != 55 ) e(4);
- if ( sum(34) != formula(34) ) e(5);
- if ( sum(101) != formula(101) ) e(6);
- if ( sum( sum(11) ) != formula( formula(11) ) ) e(7);
- if ( sum( sum(11) ) != formula( sum(11) ) ) e(8);
- if ( sum( sum( sum(4) )) != sum ( formula ( sum( 4) )) ) e(9);
- for (k = sum(-45); k<sum('a'); k += sum('b') )
- if (count++) e(10);
- if ( echo( sum ( formula( five() ))) != formula ( sum(5) ) ) e(11);
-}
-
-
-
-
-test4()
-{
- int i,j,k,l,m;
- int a[50];
- int b[1][2][3][4][5];
-
- t = 4;
- tct++;
- b[0][1][2][3][4] = one();
- if ( b[0][1][2][3][4] != 1) e(1);
- if ( b[0][one()][two()][three()][four()] != 1) e(2);
- if ( b[0][one()][five()-3][one()+2][four()] != b[0][1][2][2*2-1][4]) e(3);
- for (i=0; i<50; i++)
- a[i] = i+1;
- if (a[one()-1] != one()) e(4);
- if (echo(a[4]) != 5) e(5);
- if ( echo( a[ echo(6) ] ) != 7 ) e(6);
- if ( a[a[a[0]]] != 3 ) e(7);
- for (i=11; i<22; i++)
- if ( echo( a[i+echo('b'-'a'-1)] ) != i+1) e(8);
- for (i=0; i<1; i++)
- for (j=0; j<2; j++)
- for (k=0; k<3; k++)
- for (l=0; l<4; l++)
- for (m=0; m<5; m++)
- b[echo(i)][echo(j)][echo(k)][l][echo(m)] = j*k*l*m;
- for (i=3; i; --i)
- for (j=4; j; --j)
- if (b[0][max1( max1(0,0), 1)][2][i][j] != 1*2*echo(i)*j ) e(9);
-}
-
-
-
-
-/* More testing */
-
-
-func(sw,i)
-int sw; /* switch selector */
-int i; /* value to be returned */
-{
- int a[10];
-
- switch(sw)
- {
- case 0: return(-i);
- break;
- case 1: return ( echo(i*i) - (i-1)*i );
- break;
- case 2: return ( 2*func(0,i) );
- break;
- case 3: a[0] = 3;
- a[3] = 1;
- a[1] = 8;
- a[8] = i;
- return( 3*a[a[a[a[0]]]] );
- }
- return(-32768);
-}
-
-
-
-
-/* testing function arguments */
-
-
-
-
-f1(i,j)
-int i,j;
-{
- return( i!=j );
-}
-
-
-
-f2(ptr)
-int *ptr;
-{
- int *locptr;
-
- locptr = ptr;
- return ( *ptr | *locptr );
-}
-
-
-
-swap(a,b)
-int *a,*b;
-{
- int temp;
-
- temp = *a;
- *a = *b;
- *b = temp;
-}
-
-
-
-test5()
-{
- int k,l;
- int *ptr;
-
- t = 5;
- tct++;
- for (k = -6353; k < -6003; k++)
- if (f1(k,k+3-echo(3))) e(1);
- k = 'a' - 723;
- ptr = &k;
- if ( f2(ptr) != f2(&k) ) e(3);
- if ( f2(ptr) + f2(&k) != 2*k ) e(4);
- if ( f1(*ptr,*ptr) ) e(5);
- if ( f1(*ptr,k) ) e(6);
- if ( f1( f2(&k), *ptr ) ) e(7);
- k = l=28;
- swap(&k,&l);
- if ( k != l ) e(8);
- *ptr = k;
- swap(&k,ptr);
- if ( k != *ptr ) e(9);
- l = -5;
- k = 'h';
- ptr = &k;
- swap(ptr,&l);
- if ( l != 'h' ) e(10);
- if ( k != -5 ) e(11);
- if ( *ptr != -5 ) e(12);
- if ( ptr != &k ) e(13);
-}
-
-
-
-icount(i)
-int i;
-{
- return(i+1);
-}
-
-
-
-test6()
-{
- int i;
-
- tct++;
- t=6;
- for (i=0; i<10; i++)
- if (func(0,i) != -i) e(i);
- for (i=10; i<20; i++)
- if ( -func(2,i) != 2*i) e(i);
- if (func(func(0,0),0) != 0) e(20);
- if (func(-func(0,1),32) != 32) e(21);
- if (max1(32767,10) != max2(32767,10)) e(22);
- if (func(3,10) != 30) e(22);
- if (icount(1)!=2) e(23);
- if (icount(2)!=3) e(24);
- if (icount(32766) != 32767) e(25);
- if (icount((int)-32768) != -32767) e(26);
- if (icount(icount(1)) != 3) e(27);
- if ( icount( (int)&i ) != (int)&i + 1 ) e(28) ;
- if (icount(icount(icount(icount(icount(icount(icount(icount(0))))))))!=8) e(29);
-}
+++ /dev/null
-#include <stdio.h>
-
-int hallo()
-{
- int i = 0;
- int j = 2;
-
- i = add(i, j, i, j);
-
- return i;
-}
-
-int add(int i, int j, int k, int l)
-{
- return i + j + k +l;
-}
-
-int main() {
- printf("%d\n", hallo());
- return 0;
-}
+++ /dev/null
-long long k;
-long long k2;
-
-void f(long long a, long long b)
-{
- long long c = (a & 0xffffffffLL) | 0x100000000LL;
- k = c + b;
- k2 = a + b;
-}
-
-int main(int argc, char **argv) {
- f(0x100000000LL, 0x100000000LL);
- printf("Res: %llx %llx\n", k, k2);
- return 0;
-}
+++ /dev/null
-int x = 1;
-
-int main() {
- int a = x + x + x + x;
-
- printf("A = %d\n", a);
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-int blubber(int a, int b, int c, int d) {
- int *x = &a;
- int *y = &b;
-
- *x = c;
- *y = d;
-
- return a * b;
-}
-
-int main(void) {
- printf("Result: %d\n", blubber(2, 3, 22, 33));
- return 0;
-}
+++ /dev/null
-#!/bin/sh
-
-# move results over to public_html dir
-rm -rf "$HOME/public_html/$1"
-mv "$1" "$HOME/public_html"
-fs setacl "$HOME/public_html/$1" system:anyuser rl
+++ /dev/null
-#ifdef _WIN32
-#include <malloc.h>
-#else
-#include <alloca.h>
-#endif
-
-#include <stdio.h>
-
-struct x {
- int a, b;
-};
-
-static void t(struct x *p)
-{
- printf("%d\n", p->a + p->b);
-}
-
-static void t2()
-{
- char *mem;
-
- printf("hallo\n");
- mem = alloca(23);
-
- printf("%.0s", mem);
-}
-
-int main(int argc, char *argv[])
-{
- struct x *p = alloca(sizeof(*p));
-
- p->a = argc;
- p->b = 3;
-
- t(p);
- t2();
-
- return 0;
-}
+++ /dev/null
-int a = 42;
-int array[32];
-int b = 990100;
-
-int main(void)
-{
- int c = a+b;
-
- array[0] = c + 1;
- array[1] = c + 2;
- array[2] = c + 3;
- array[3] = c + 4;
- array[4] = c + 5;
- array[5] = c + 6;
- array[6] = c + 7;
- array[7] = c + 8;
- array[8] = c + 9;
- array[9] = c + 10;
- array[10] = c + 11;
- array[11] = c + 12;
- array[12] = c + 13;
- array[13] = c + 14;
- array[14] = c + 15;
- array[15] = c + 16;
- array[16] = c + 17;
- array[17] = c + 18;
- array[18] = c + 19;
- array[29] = c + 20;
- array[20] = c + 21;
- array[21] = c + 22;
- array[22] = c + 23;
- array[23] = c + 24;
- array[24] = c + 25;
- array[25] = c + 26;
- array[26] = c + 27;
- array[27] = c + 28;
- array[28] = c + 29;
- array[29] = c + 30;
- array[30] = c + 31;
- array[31] = c + 32;
-
- return array[10] - a - b - 11;
-}
+++ /dev/null
-/*
- B - base
- IN - index
- IS - index (shifted)
- C - const
- SC - symconst
-
- # | B | I | IS | C | SC | note
- -------+-------+-------+-------+-------+-------+-------------------------------
- 00 | | | | | | senseless
- 01 | | | | | x |
- 02 | | | | x | | senseless ?
- 03 | | | | x | x |
- 04 | | | x | | | missing base ?
- 05 | | | x | | x | missing base ?
- 06 | | | x | x | | missing base ?
- 07 | | | x | x | x | missing base ?
- 08 | | x | | | | missing base
- 09 | | x | | | x | missing base
- 10 | | x | | x | | missing base
- 11 | | x | | x | x | missing base
- 12 | | x | x | | | impossible
- 13 | | x | x | | x | impossible
- 14 | | x | x | x | | impossible
- 15 | | x | x | x | x | impossible
- 16 | x | | | | |
- 17 | x | | | | x |
- 18 | x | | | x | |
- 19 | x | | | x | x |
- 20 | x | | x | | |
- 21 | x | | x | | x |
- 22 | x | | x | x | |
- 23 | x | | x | x | x |
- 24 | x | x | | | |
- 25 | x | x | | | x |
- 26 | x | x | | x | |
- 27 | x | x | | x | x |
- 28 | x | x | x | | | impossible
- 29 | x | x | x | | x | impossible
- 30 | x | x | x | x | | impossible
- 31 | x | x | x | x | x | impossible
- */
-
-char sc[100];
-char* sc_pointers[100];
-char c;
-
-int main(int argc, char **argv)
-{
- return 0;
-}
-
-/* Source address modes */
-
-void load_01(void)
-{
- c = sc[0];
-}
-
-void load_03(void)
-{
- c = sc[1];
-}
-
-void load_16(char* base)
-{
- c = base[0];
-}
-
-void load_17(int base)
-{
- c = sc[base];
-}
-
-void load_18(char* base)
-{
- c = base[1];
-}
-
-void load_19(int base)
-{
- c = sc[base + 1];
-}
-
-void load_20_add(char* base, int index)
-{
- c = base[2 * index];
-}
-
-void load_20_shift(char* base, int index)
-{
- c = base[4 * index];
-}
-
-void load_21_add(int base, int index)
-{
- c = sc[base + 2 * index];
-}
-
-void load_21_shift(int base, int index)
-{
- c = sc[base + 4 * index];
-}
-
-void load_22_add(char* base, int index)
-{
- c = base[2 * index + 1];
-}
-
-void load_22_shift(char* base, int index)
-{
- c = base[4 * index + 1];
-}
-
-void load_23_add(int base, int index)
-{
- c = sc[base + 2 * index + 1];
-}
-
-void load_23_shift(int base, int index)
-{
- c = sc[base + 4 * index + 1];
-}
-
-void load_24(char* base, int index)
-{
- c = base[index];
-}
-
-void load_25(int base, int index)
-{
- c = sc[base + index];
-}
-
-void load_26(char* base, int index)
-{
- c = base[index + 1];
-}
-
-void load_27(int base, int index)
-{
- c = sc[base + index + 1];
-}
-
-/* Destination address modes */
-
-void store_immediate_01(void)
-{
- sc_pointers[0] = sc + 42;
-}
-
-void store_immediate_03(void)
-{
- sc_pointers[1] = sc + 42;
-}
-
-void store_immediate_16(char** base)
-{
- base[0] = sc + 42;
-}
-
-void store_immediate_17(int base)
-{
- sc_pointers[base] = sc + 42;
-}
-
-void store_immediate_18(char** base)
-{
- base[1] = sc + 42;
-}
-
-void store_immediate_19(int base)
-{
- sc_pointers[base + 1] = sc + 42;
-}
-
-void store_immediate_20_add(char** base, int index)
-{
- base[2 * index] = sc + 42;
-}
-
-void store_immediate_20_shift(char** base, int index)
-{
- base[4 * index] = sc + 42;
-}
-
-void store_immediate_21_add(int base, int index)
-{
- sc_pointers[base + 2 * index] = sc + 42;
-}
-
-void store_immediate_21_shift(int base, int index)
-{
- sc_pointers[base + 4 * index] = sc + 42;
-}
-
-void store_immediate_22_add(char** base, int index)
-{
- base[2 * index + 1] = sc + 42;
-}
-
-void store_immediate_22_shift(char** base, int index)
-{
- base[4 * index + 1] = sc + 42;
-}
-
-void store_immediate_23_add(int base, int index)
-{
- sc_pointers[base + 2 * index + 1] = sc + 42;
-}
-
-void store_immediate_23_shift(int base, int index)
-{
- sc_pointers[base + 4 * index + 1] = sc + 42;
-}
-
-void store_immediate_24(char** base, int index)
-{
- base[index] = sc + 42;
-}
-
-void store_immediate_25(int base, int index)
-{
- sc_pointers[base + index] = sc + 42;
-}
-
-void store_immediate_26(char** base, int index)
-{
- base[index + 1] = sc + 42;
-}
-
-void store_immediate_27(int base, int index)
-{
- sc_pointers[base + index + 1] = sc + 42;
-}
+++ /dev/null
-/*$ -fno-inline $*/
-
-#include <stdio.h>
-
-int val;
-
-#define TTYPE(name,type,OP) \
- type test_##name##type(void) { return val OP 7; } \
- type test2_##name##type(type v) { return val OP v; } \
- type testp_##name##type(void) { return 7 OP val; } \
- type testp2_##name##type(type v) { return v OP val; }
-
-int test_cmp_testset(int v, int v2) { return (v & 14) > 0; }
-
-#define T(name,OP) \
- TTYPE(name,int,OP) \
- TTYPE(name,short,OP) \
- TTYPE(name,char,OP)
-
-T(add,+)
-T(sub,-)
-T(or,|)
-T(and,&)
-T(xor,^)
-T(cmp,<)
-T(shl,<<)
-T(shr,>>)
-
-#undef T
-#undef TTYPE
-
-int main(void) {
- int res1, res2, res3, res4;
- val = 11;
-
-#define TTYPE(name,type,OP) \
- res1 = test_##name##type(); \
- res2 = test2_##name##type(20); \
- res3 = testp_##name##type(); \
- res4 = testp2_##name##type(20); \
- printf("Test %s: %d (should be %d)\n", #name, res1, (type) 11 OP (type) 7); \
- printf("Test2 %s: %d (should be %d)\n", #name, res2, (type) 11 OP (type)20); \
- printf("Testp %s: %d (should be %d)\n", #name, res3, (type) 7 OP (type)11); \
- printf("Testp2 %s: %d (should be %d)\n", #name, res4, (type) 20 OP (type)11);
-
-#define T(name,OP) \
- TTYPE(name,int,OP) \
- TTYPE(name,short,OP) \
- TTYPE(name,char,OP)
-
- T(add,+)
- T(sub,-)
- T(or,|)
- T(and,&)
- T(xor,^)
- T(cmp,<)
- T(shl,<<)
- T(shr,>>)
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-#include <stdlib.h>
-
-int arr[10] = { 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 };
-
-int sum(int from, int to) {
- int i, res = 0, res2 = 666;
- int len = to - from;
-
- for(i = 0; i < len; ++i) {
- res += arr[from + i];
- res2 -= arr[i];
- }
-
- return res ^ res2;
-}
-
-int main(int argc, char **argv) {
- int from = 0;
- int to = 10;
- if(argc > 1)
- to = atoi(argv[1]);
-
- printf("Res: %d\n", sum(from, to));
- return 0;
-}
+++ /dev/null
-/*$ -fno-inline $*/
-
-char arr[] = { 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
- 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 };
-
-int sum(int c, int offs) {
- int i, res = 0;
-
- for(i = 0; i < c; ++i) {
- res += arr[i * 2 + offs + 2];
- }
-
- return res;
-}
-
-int main(void) {
- printf("Sum: %d\n", sum(10, 0));
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-char c;
-
-int f(int x, int y) {
- return x + y * 8;
-}
-
-int f2(int x, int y) {
- return x * 2 + y * 8;
-}
-
-int f3(int x) {
- return x * 2;
-}
-
-char f4(char *p, int k) {
- return p[k];
-}
-
-short f5(short *p, int k) {
- return p[k];
-}
-
-#define TTYPE(name, type, OP, OP2) \
-void dest_am_##name##type(type *arr, int from, int to) { \
- int i; \
- \
- for(i = from; i < to; ++i) { \
- arr[i] = OP arr[i] OP2; \
- } \
-}
-
-#define T(name, OP, OP2) \
- TTYPE(name,int,OP,OP2) \
- TTYPE(name,short,OP,OP2) \
- TTYPE(name,char,OP,OP2)
-
-T(neg, -,)
-T(not, ~,)
-T(add, 3 +,)
-T(sub, , - 42)
-T(and, 0x12345 &,)
-T(or, 0x12345 |,)
-T(xor, 0x12345 ^,)
-T(inc, 1 + ,)
-T(dec, , - 1)
-T(shl, , << 3)
-T(shr, , >> 3)
-
-int main(void) {
- int arrint[] = { 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 };
- short arrshort[] = { 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 };
- char arrchar[] = { 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 };
-
- int i;
-
-#define CTYPE(type,name) dest_am_##name##type(arr##type, 0, 10); \
- for(i = 0; i < 10; ++i) { \
- printf("%d ", arr##type[i]); \
- } \
- printf("\n");
-
-#define C(name) \
- CTYPE(int,name) \
- CTYPE(short,name) \
- CTYPE(char,name)
-
- C(neg);
- C(not);
- C(add);
- C(sub);
- C(and);
- C(or);
- C(inc);
- C(dec);
- C(xor);
-
- return 0;
-}
+++ /dev/null
-struct s {
- int m1;
- int m2;
- int m3;
- int m4;
-};
-
-int i = 3;
-
-int main(int argc, char **argv) {
- struct s a[100];
- i = a[i].m1;
-
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-static int test(int a, int i)
-{
- a &= ~(1 << (i & 0x0000001F));
- return a;
-}
-
-int A = 15;
-int I = 3;
-
-int main()
-{
- printf("test(%d, %d) = %d\n", A, I, test(A,I));
-
- return 0;
-}
+++ /dev/null
-float o=0.075,h=1.5,T,r,O,l,I;int _,L=80,s=3200;main(){for(;s%L||
-(h-=o,T= -2),s;4 -(r=O*O)<(l=I*I)|++ _==L&&write(1,(--s%L?_<L?--_
-%6:6:7)+"Sascha \n",1)&&(O=I=l=_=r=0,T+=o /2))O=I*2*O+h,I=l+T-r;}
+++ /dev/null
-#include <stdio.h>
-
-float o=0.075,h=1.5,T,r,O,l,I;
-int _,L=80,s=3200;
-
-int main(int argc, char *argv[]){
- for (; s;) {
- if (s%L == 0) {
- h -= o;
- T = -2;
- }
-
- O = I*2*O+h;
- I = l+T-r;
- if (4 -(r=O*O)<(l=I*I) | ++_==L) {
- int index = --s%L ? (_ < L ? --_ %6:6) : 7;
- char c = "Sascha \n"[index];
- putchar(c);
- O = I = l = _ = r = 0;
- T += o/2;
- }
- }
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-int arr0[] = { 0, 1, 2, 3 };
-int arr1[4] = { 3, 2, 1 };
-int arrm[3][4] = { {1}, {2,3,4,5}, {6, 7, 8 } };
-
-int main()
-{
- int i, i2;
-
- for(i = 0; i < (sizeof(arr0)/sizeof(arr0[0])); ++i) {
- printf("arr0[%d] = %d\n", i, arr0[i]);
- }
- for(i = 0; i < 4; ++i) {
- printf("arr1[%d] = %d\n", i, arr1[i]);
- }
- for(i = 0; i < 4; ++i) {
- for(i2 = 0; i2 < 3; ++i2) {
- printf("arrm[%d][%d] = %d\n", i2, i, arrm[i2][i]);
- }
- }
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-int foo[255][4];
-
-int bar[4] = { 0, 1, 2, 3 };
-
-int main(void) {
- printf("bar: %d %d %d %d (should be 0 1 2 3)\n", bar[0], bar[1], bar[2], bar[3]);
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-#include <assert.h>
-
-#ifdef __i386__
-static inline unsigned char inb(const unsigned short port)
-{
- unsigned char val;
-
- __asm__ __volatile__ ("inb %w1, %0" : "=a"(val) : "dN"(port));
-
- return val;
-}
-
-static inline void outb(const unsigned short port, const unsigned char val)
-{
- int k = val; /* just here to test the b modifier in %b0 */
- __asm__ __volatile__ ("outb %b0, %1" : : "a"(k), "dN"(port));
-}
-
-static void sincostest(double arg)
-{
- double cos, sin;
-
- __asm__ ("fsincos" : "=t"(cos), "=u"(sin) : "0" (arg));
- printf("Arg: %f Sin: %f Cos: %f\n", arg, sin, cos);
-}
-
-static inline int mov_noeax(int val)
-{
- int res;
-
- __asm__ ("movl %1, %0" : "=r"(res) : "ri" (val) : "eax");
-
- return res;
-}
-
-static inline unsigned short swap16(unsigned short x)
-{
- __asm__("xchgb %b0, %h0 /* in: %1 out: %0 */" : "=q" (x) : "0" (x));
- return x;
-}
-
-static inline unsigned int swap32(unsigned int x)
-{
- __asm__("bswap %0 /* %1 */" : "=r" (x) : "0" (x));
- return x;
-}
-
-void inc(int *v)
-{
- __asm__("incl %0" : "+rm" (*v) : : "cc");
-}
-
-void inc2(int *v)
-{
- __asm__("incl %0" : "+m" (*v) : : "cc");
-}
-
-#if 1
-typedef struct kernel_fd_set {
- int bla;
- int blup;
-} kernel_fd_set;
-#else
-typedef int kernel_fd_set;
-#endif
-
-void fd_set(int fd, kernel_fd_set* set) {
- __asm__("btsl %1,%0" : "=m" (*(set)) : "r" (fd) : "cc");
-}
-
-int fd_isset(int fd, kernel_fd_set *set) {
- unsigned char result;
-
- __asm__ __volatile__("btl %1,%2\n"
- "\tsetb %0"
- : "=q" (result)
- : "r" (fd), "m" (*set)
- : "cc");
- return result;
-}
-
-int justcompile(void)
-{
- outb(123, 42);
- outb(12345, 42);
- return inb(20) + inb(5);
-}
-
-int main()
-{
- kernel_fd_set s;
- int k;
-
- fd_set(20, &s);
- assert(fd_isset(20, &s));
-
- printf("Swap16(0xAABB): %X Swap32(0xAABBCCDD): %X\n",
- swap16(0xAABB), swap32(0xAABBCCDD));
- k = 41;
- inc(&k);
- printf("mov(inc(41)): %d\n", mov_noeax(k));
-
- return mov_noeax(0);
-}
-
-#else
-
-int main()
-{
- printf("Warning: asmtest only work on x86\n");
- return 0;
-}
-
-#endif
+++ /dev/null
-
-int main(int argc, char **argv) {
- int i;
-
- for(i = 0; i < 10; ++i) {
- __asm__ __volatile__("/* dummy3 */"
- : : : "eax", "ebx", "ecx", "edx", "esi", "edi" );
- }
-
- if(argc) {
- if(argc * 2 > 14) {
- __asm__ __volatile__("/* dummy */");
- } else {
- __asm__ __volatile__("/* dummy2 */");
- }
- }
-
- return 0;
-}
+++ /dev/null
-/* THIS IS WRONG, but gcc compiles it: (unsigned int)x is NO lvalue */
-#define udiv_qrnnd(q, r, n1, n0, dv) \
- __asm__ ("divl %4" \
- : "=a" ((unsigned int) (q)), \
- "=d" ((unsigned int) (r)) \
- : "0" ((unsigned int) (n0)), \
- "1" ((unsigned int) (n1)), \
- "rm" ((unsigned int) (dv)))
-
-unsigned int X;
-unsigned test(void) {
- unsigned int d0, n0, n1, q0;
-
- n1 = n0 = d0 = X;
-
- udiv_qrnnd (q0, n0, n1, n0, d0);
-
- return q0;
-}
-
-int main(void) {
- return 0;
-}
+++ /dev/null
-unsigned long get_sp(void)
-{
- unsigned long esp;
- __asm__("movl %%esp, %0" : "=mr" (esp));
- return esp;
-}
-
-int main(void) {
- printf("stack pointer available: %d\n", get_sp() > 42);
- return 0;
-}
+++ /dev/null
-
-unsigned get(void)
-{
- unsigned a;
- __asm__(" movl $17,%0 ": "=D"(a));
- return a;
-}
-
-int main(void) {
- printf("a: %u\n", get());
- return 0;
-}
+++ /dev/null
-/*$ -fomit-frame-pointer -O3 $*/
-
-int main(void)
-{
- int in = 42;
- int out;
- __asm__(
- "xorl %%eax,%%eax\n"
- "xorl %%ebx,%%ebx\n"
- "xorl %%ecx,%%ecx\n"
- "xorl %%edx,%%edx\n"
- "xorl %%esi,%%esi\n"
- "xorl %%edi,%%edi\n"
- "movl %1,%0\n"
- "incl %0\n"
- : "=r" (out) : "r" (in)
- : "eax", "ebx", "ecx", "edx", "esi", "edi", "cc"
- );
-
- return out != 43;
-}
+++ /dev/null
-#include <stdio.h>
-#include <stdlib.h>
-
-unsigned int
-f1 (int diff)
-{
- return ((unsigned int) (diff < 0 ? -diff : diff));
-}
-
-unsigned int
-f2 (unsigned int diff)
-{
- return ((unsigned int) ((signed int) diff < 0 ? -diff : diff));
-}
-
-unsigned long long
-f3 (long long diff)
-{
- return ((unsigned long long) (diff < 0 ? -diff : diff));
-}
-
-unsigned long long
-f4 (unsigned long long diff)
-{
- return ((unsigned long long) ((signed long long) diff < 0 ? -diff : diff));
-}
-
-int main ()
-{
- int i;
- for (i = 0; i <= 10; i++)
- {
-#if 0
- if (f1 (i) != i) {
- printf("f1(%d)\n", i);
- abort ();
- }
- if (f1 (-i) != i) {
- printf("f1(%d)\n", -i);
- abort ();
- }
- if (f2 (i) != i) {
- printf("f2(%d)\n", i);
- abort ();
- }
-#endif
- if ((int) f2 (-i) != i) {
- printf("f2(%d) -> %d\n", -i, f2(-i));
- abort ();
- }
-#if 0
- if (f3 ((long long) i) != i) {
- printf("f3(%lld)\n", i);
- abort ();
- }
- if (f3 ((long long) -i) != i) {
- printf("f3(%lld)\n", -i);
- abort ();
- }
- if (f4 ((long long) i) != i) {
- printf("f4(%lld)\n", i);
- abort ();
- }
- if (f4 ((long long) -i) != i) {
- printf("f4(%d)\n", -i);
- abort ();
- }
-#endif
- }
- exit (0);
-}
+++ /dev/null
-//#include <stdio.h>
-
-/* Demonstrates a bug where constant folding ignores width of bitfields */
-
-#ifdef __GNUC__
-#define PACKED __attribute__((packed))
-#else
-#define PACKED
-#endif
-
-struct PACKED A
-{
- unsigned int i:1, l:1, j:3, k:11;
-};
-struct A sA;
-
-int main()
-{
- unsigned int mask;
- struct A x;
-
- sA.k = -1;
- mask = sA.k;
- x = sA;
-
- printf("Val1: %x (expected 7ff) val2: %x (expected 7ff)\n", mask, x.k);
-
- return 0;
-}
+++ /dev/null
-#include "dumpmem.h"
-
-struct bf {
- int a;
- unsigned x:13;
- unsigned y:17;
- unsigned z:3;
- unsigned char c;
- double d;
- unsigned w:9;
-};
-
-struct bf mybf = { 0xffffffff, 4097, 65537, 5, 0xff, 4.5, 257 };
-
-int main() {
-
- dumpMem(&mybf, sizeof mybf);
- printf("sizeof mybf %d\n", sizeof mybf);
-
- printf("int a (expected -1): %d\n", mybf.a);
- printf("unsigned x:13 (expected 4097): %u\n", mybf.x);
- printf("unsigned y:17 (expected 65537): %u\n", mybf.y);
- printf("unsigned y:3 (expected 5): %u\n", mybf.z);
- printf("unsigned char c (expected ff): %x\n", (unsigned)mybf.c);
- printf("double d (expected 4.5): %.1f\n", mybf.d);
- printf("unsigned w:9 (expected 257): %u\n", mybf.w);
-
- return 0;
-}
+++ /dev/null
-#include <stdlib.h>
-#include <string.h>
-#include "dumpmem.h"
-
-struct bf {
- int a;
- unsigned x:13;
- unsigned y:17;
- unsigned z:3;
- unsigned char c;
- double d;
- unsigned w:9;
-};
-
-#ifdef offsetof
-#undef offsetof
-#endif
-#define offsetof(TYPE, MEMB) ((char*) (&((TYPE *)0)->MEMB) - (char*) 0)
-
-int main(int argc, char **argv) {
- struct bf mybf = { 0xffffffff, 4097, 65537, 5, 0xff, 4.5, 257 };
-
- if(argc > 1)
- dumpMem(&mybf, sizeof mybf);
- printf("sizeof mybf %d\n", sizeof mybf);
- printf("offset a = %d\n", offsetof(struct bf, a));
- printf("offset c = %d\n", offsetof(struct bf, c));
- printf("offset d = %d\n", offsetof(struct bf, d));
-
- printf("int a (expected -1): %d\n", mybf.a);
- printf("unsigned x:13 (expected 4097): %u\n", mybf.x);
- printf("unsigned y:17 (expected 65537): %u\n", mybf.y);
- printf("unsigned y:3 (expected 5): %u\n", mybf.z);
- printf("unsigned char c (expected ff): %x\n", mybf.c);
- printf("double d (expected 4.5): %.1f\n", mybf.d);
- printf("unsigned w:9 (expected 257): %u\n", mybf.w);
-
- return 0;
-}
+++ /dev/null
-#include "dumpmem.h"
-
-struct bf {
- unsigned x:13;
- unsigned y:17;
- unsigned z:3;
- unsigned w:9;
-} mybf;
-
-
-int main(void) {
-
- mybf.x = 4097;
- mybf.y = 65537;
- mybf.z = 5;
- mybf.w = 257;
-
- dumpMem(&mybf, sizeof mybf);
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-static int m = 754974721;
-static int N;
-static int t[1 << 22];
-static int a;
-static int *p;
-static int i;
-//static int e = 1 << 22;
-static int e = 1 << 10;
-static int j;
-static int s;
-static int b;
-static int c;
-static int U;
-
-void f(int d)
-{
- for (s = 1 << 23; s; s /= 2, d = d * 1L * d % m) {
- if (s >= N) continue;
- for (p = t; p < t + N; p += s) {
- for (i = s, c = 1; i; i--) {
- b = *p + p[s], p[s] = (m + *p - p[s]) *
- 1L * c % m, *p++ = b % m, c = c * 1L * d % m;
- }
- }
- }
-
- for (j = 0; i < N - 1;)
- {
- for (s = N / 2; !((j ^= s) & s); s /= 2)
- {}
-
- if (++i < j)
- a = t[i], t[i] = t[j], t[j] = a;
- }
-}
-
-int main ()
-{
- *t = 2;
- U = N = 1;
-
- while (e /= 2) {
- N *= 2;
- U = U * 1L * (m + 1) / 2 % m;
- f(362);
- for (p = t; p < t + N;)
- *p++ = (*p * 1L * *p % m) * U % m;
-
- f(415027540);
- for (a = 0, p = t; p < t + N;) {
- a += (0x6A64B1 & e ? 2 : 1) * *p;
- *p++ = a % 10;
- a /= 10;
- }
- }
-
- while (!*--p)
- ;
-
- t[0]--;
- {
- int qs = 0;
- while (p >= t)
- qs += *p--;
- printf ("Checksumme = %d\n", qs);
- }
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-struct a {
- unsigned int i:1;
-};
-
-struct b {
- int x:20;
- int y:8;
- int z:10;
-};
-
-struct b B = { -1, 2, 3 };
-struct b C = { -1, 2, 3 };
-
-int main()
-{
- printf("sizeof(struct a) = %zu\n", sizeof(struct a));
- printf("sizeof(B) = %d\n", sizeof(B));
-
- printf("x = %d\n", B.x);
- printf("y = %d\n", B.y);
- printf("z = %d\n", B.z);
-
- B.y = C.z;
-
- if (C.z)
- return 0;
-
- return 42;
-}
+++ /dev/null
-
- int a, b, c, d, e;
-
-int main(void) {
- c = a & b;
- d = c | a;
- e = b ^ d;
- return 0;
-}
+++ /dev/null
-#include <stdlib.h>
-
-int A, B, C;
-
-int test(int a, int b, int c) {
- switch (a) {
- case 1:
- B = b;
- return A + c;
- case 2:
- B = c;
- return c + A;
- case 3:
- return c + A;
- case 4:
- abort();
- }
- abort();
-}
-
-int main(int argc, char *argv[]) {
- return 0;
-}
+++ /dev/null
-/*$ -fno-inline $*/
-#include <limits.h>
-#include <stdio.h>
-#include <assert.h>
-
-int f(int a, int b)
-{
- return a < 0 & b < 0;
-}
-
-int f2(short a, short b)
-{
- return a < b && b < a;
-}
-
-int f3(short a, short b)
-{
- return a < b && b > a;
-}
-
-int f4(short a, short b, short c)
-{
- return (a <= c) & (b <= c);
-}
-
-int g(unsigned a, unsigned b)
-{
- return ((a >> 12) | 5) & ((b >> 12) | 5);
-}
-
-int g2(unsigned a, unsigned b)
-{
- return (a & 5) | (b & 5);
-}
-
-int g3(int a, int b, int z)
-{
- return (a | z) & (b | z);
-}
-
-int imp(int a, int b)
-{
- /* logical implication */
- return (a < b) <= (a <= b);
-}
-
-int eq(int a, int b)
-{
- return (a < b) == (a <= b);
-}
-
-int neq(int a, int b)
-{
- return (a < b) != (a <= b);
-}
-
-int af(int a)
-{
- return (a ? 1 : 0) && !a;
-}
-
-int at(int a)
-{
- return (a ? 1 : 0) || !a;
-}
-
-int c(int a, int b)
-{
- return a < b || a == b;
-}
-
-int c2(int a, int b)
-{
- return a < b && a <= b;
-}
-
-int c3(int a, int b)
-{
- return a < b || a >= b;
-}
-
-int c4(int a, int b)
-{
- return a < b ^ a <= b;
-}
-
-int main()
-{
-#define UOP(func,val,should_be) { printf("%s(%d) -> %d (should be %d)\n", #func, val, func(val), should_be); assert(func(val) == should_be); }
-#define BOP(func,val1,val2,should_be) { printf("%s(%d,%d) -> %d (should be %d)\n", #func, val1, val2, func(val1,val2), should_be); assert(func(val1,val2) == should_be); }
-#define TOP(func,val1,val2,val3,should_be) { printf("%s(%d,%d,%d) -> %d (should be %d)\n", #func, val1, val2, val3, func(val1,val2,val3), should_be); assert(func(val1,val2,val3) == should_be); }
- BOP(f, 0, 0, 0);
- BOP(f, -1, 0, 0);
- BOP(f, 0, -42, 0);
- BOP(f, -1, 1, 0);
- BOP(f, -42, -23, 1);
- BOP(f, 13, -1, 0);
- BOP(f, -1, -1, 1);
- BOP(f, INT_MIN, INT_MIN, 1);
- BOP(f, INT_MIN, -1, 1);
- BOP(f, -1, INT_MIN, 1);
-
- BOP(f2, 0, 0, 0);
- BOP(f2, -1, 0, 0);
- BOP(f2, 0, -42, 0);
- BOP(f2, -1, 1, 0);
- BOP(f2, -42, -23, 0);
- BOP(f2, 13, -1, 0);
- BOP(f2, -1, -1, 0);
- BOP(f2, SHRT_MIN, SHRT_MIN, 0);
- BOP(f2, SHRT_MIN, -1, 0);
- BOP(f2, -1, SHRT_MIN, 0);
-
- BOP(f3, 0, 0, 0);
- BOP(f3, -1, 0, 1);
- BOP(f3, 0, -42, 0);
- BOP(f3, -1, 1, 1);
- BOP(f3, -42, -23, 1);
- BOP(f3, 13, -1, 0);
- BOP(f3, -1, -1, 0);
- BOP(f3, SHRT_MIN, SHRT_MIN, 0);
- BOP(f3, SHRT_MIN, -1, 1);
- BOP(f3, -1, SHRT_MIN, 0);
-
- TOP(f4, 1, 2, 3, 1);
- TOP(f4, -1, -2, -3, 0);
- TOP(f4, SHRT_MIN, SHRT_MIN, -1, 1);
- TOP(f4, SHRT_MIN, SHRT_MIN, SHRT_MIN, 1);
- TOP(f4, SHRT_MAX, SHRT_MIN, SHRT_MAX, 1);
- TOP(f4, SHRT_MIN, SHRT_MIN, SHRT_MAX, 1);
- TOP(f4, 13, 42, SHRT_MAX, 1);
- TOP(f4, 0, 0, 0, 1);
- TOP(f4, 1, 1, 1, 1);
-
- BOP(g, UINT_MAX, UINT_MAX, 1048575);
- BOP(g, 0, 0, 5);
- BOP(g, 12345, 54321, 5);
-
- BOP(g2, UINT_MAX, UINT_MAX, 5);
- BOP(g2, 0, 0, 0);
- BOP(g2, 12345, 54321, 1);
-
- BOP(imp, UINT_MAX, UINT_MAX, 1);
- BOP(imp, 0, 0, 1);
- BOP(imp, 12345, 54321, 1);
- BOP(imp, 42, 23, 1);
-
- BOP(eq, UINT_MAX, UINT_MAX, 0);
- BOP(eq, 0, 0, 0);
- BOP(eq, 12345, 54321, 1);
- BOP(eq, 42, 23, 1);
-
- BOP(neq, UINT_MAX, UINT_MAX, 1);
- BOP(neq, 0, 0, 1);
- BOP(neq, 12345, 54321, 0);
- BOP(neq, 42, 23, 0);
-
- TOP(g3, 1, 2, 3, 3);
- TOP(g3, -1, -2, -3, -1);
- TOP(g3, INT_MIN, INT_MIN, -1, -1);
- TOP(g3, INT_MIN, INT_MIN, INT_MIN, INT_MIN);
- TOP(g3, INT_MAX, INT_MIN, INT_MAX, INT_MAX);
- TOP(g3, INT_MIN, INT_MIN, INT_MAX, -1);
- TOP(g3, 13, 42, INT_MAX, INT_MAX);
- TOP(g3, 0, 0, 0, 0);
- TOP(g3, 1, 1, 1, 1);
-
- UOP(af, 0, 0);
- UOP(af, 1, 0);
- UOP(af, 42, 0);
- UOP(af, -1, 0);
-
- UOP(at, 0, 1);
- UOP(at, 1, 1);
- UOP(at, 42, 1);
- UOP(at, -1, 1);
-
- BOP(c, 0, 0, 1);
- BOP(c, -1, 0, 1);
- BOP(c, 0, -42, 0);
- BOP(c, -1, 1, 1);
- BOP(c, -42, -23, 1);
- BOP(c, 13, -1, 0);
- BOP(c, -1, -1, 1);
- BOP(c, SHRT_MIN, SHRT_MIN, 1);
- BOP(c, SHRT_MIN, -1, 1);
- BOP(c, -1, SHRT_MIN, 0);
-
- BOP(c2, 0, 0, 0);
- BOP(c2, -1, 0, 1);
- BOP(c2, 0, -42, 0);
- BOP(c2, -1, 1, 1);
- BOP(c2, -42, -23, 1);
- BOP(c2, 13, -1, 0);
- BOP(c2, -1, -1, 0);
- BOP(c2, SHRT_MIN, SHRT_MIN, 0);
- BOP(c2, SHRT_MIN, -1, 1);
- BOP(c2, -1, SHRT_MIN, 0);
-
- BOP(c3, 0, 0, 1);
- BOP(c3, -1, 0, 1);
- BOP(c3, 0, -42, 1);
- BOP(c3, -1, 1, 1);
- BOP(c3, -42, -23, 1);
- BOP(c3, 13, -1, 1);
- BOP(c3, -1, -1, 1);
- BOP(c3, SHRT_MIN, SHRT_MIN, 1);
- BOP(c3, SHRT_MIN, -1, 1);
- BOP(c3, -1, SHRT_MIN, 1);
-
- BOP(c4, 0, 0, 1);
- BOP(c4, -1, 0, 0);
- BOP(c4, 0, -42, 0);
- BOP(c4, -1, 1, 0);
- BOP(c4, -42, -23, 0);
- BOP(c4, 13, -1, 0);
- BOP(c4, -1, -1, 1);
- BOP(c4, SHRT_MIN, SHRT_MIN, 1);
- BOP(c4, SHRT_MIN, -1, 0);
- BOP(c4, -1, SHRT_MIN, 0);
-
- return 0;
-}
+++ /dev/null
-int range0(int a)
-{
- return 0 <= a && a < 10;
-}
-
-int range1(int a)
-{
- return 1 <= a && a < 10;
-}
-
-int test_lt_and_lt(int a)
-{
- return a < 5 && a < 10;
-}
-
-int test_lt_and_eq(int a)
-{
- return a < 5 && a == 10;
-}
-
-int test_lt_and_gt(int a)
-{
- return a < 5 && a > 10;
-}
-
-int test_eq_and_lt(int a)
-{
- return a == 5 && a < 10;
-}
-
-int test_eq_and_eq(int a)
-{
- return a == 5 && a == 10;
-}
-
-int test_eq_and_gt(int a)
-{
- return a == 5 && a > 10;
-}
-
-int test_ge_and_lt(int a)
-{
- return a >= 5 && a < 6;
-}
-
-int test_gt_and_lt(int a)
-{
- return a > 5 && a < 6;
-}
-
-int test_lt_or_lt(int a)
-{
- return a < 5 || a < 10;
-}
-
-int test_lt_or_eq(int a)
-{
- return a < 5 || a == 5;
-}
-
-int test_ne_or_ne(int a)
-{
- return a != 5 || a != 10;
-}
-
-int main(void)
-{
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-int bttest(int x, int n) {
- if (x & (1 << n))
- return 1;
- return 0;
-}
-
-int nbttest(int x, int n) {
- if (!(x & (1 << n)))
- return 1;
- return 0;
-}
-
-int bttest1(int x, int n) {
- if ((x & (1 << n)) == (1 << n))
- return 1;
- return 0;
-}
-
-int bttest2(int x, int n) {
- if ((x & (1 << n)) != (1 << n))
- return 1;
- return 0;
-}
-
-int main() {
- printf("%d\n", bttest(128, 7));
- printf("%d\n", nbttest(128, 7));
- printf("%d\n", bttest1(128, 7));
- printf("%d\n", bttest2(128, 7));
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-void func(int *i)
-{
- *i = 0;
-}
-
-int main (int argc, char *argv[]) {
- int i;
-
- printf("callref.c\n");
-
- func(&i);
-
- printf(" i = %d (should be 0)\n", i);
-
- return 0;
-}
+++ /dev/null
-#if 0
-
-int test(int a, int b, int c, int d, int e, int f, int g, int h, int i)
-{
- x(a);
- x(a, b);
- x(a, b, c);
- x(a, b, c, d);
- x(a, b, c, d, e);
- x(a, b, c, d, e, f);
- x(a, b, c, d, e, f, g);
- x(a, b, c, d, e, f, g, h);
- x(a, b, c, d, e, f, g, h, i);
-}
-
-#endif
-
-
-int test(int a, int b, int c)
-{
- int d, e;
-
- d = a/b;
-// e = b/c;
-
- return d;
-}
-
-int main()
-{
- printf("Result: %d\n", test(1,2,3));
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-#include <assert.h>
-
-struct list {
- struct list *next;
- int val;
-};
-
-struct list l = { NULL, 5 };
-struct list *sptr = &l;
-struct list l2 = { NULL, 42 };
-struct list *sptr2 = &l2;
-
-struct list *test(int n)
-{
- struct list *ptr1;
- struct list *ptr2;
- int sum = 0;
-
- if(n == 0) {
- ptr1 = sptr;
- } else {
- ptr1 = sptr2;
- }
-
- for(ptr2 = ptr1; ptr2 != NULL; ptr2 = ptr2->next) {
- sum += ptr2->val;
- }
- printf("Sum: %d\n", sum);
-
- return ptr1;
-}
-
-int main(int argc, char **argv)
-{
- struct list *ptr1 = test(0);
- struct list *ptr2 = test(1);
-
- assert(ptr1 == sptr);
- assert(ptr2 == sptr2);
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-int cmp1(int a, int b)
-{
- return a < b;
-}
-
-int cmp2(int a, int b)
-{
- return a > b;
-}
-
-int cmp3(int a)
-{
- return a < 3;
-}
-
-int cmp4(int a)
-{
- return a > 3;
-}
-
-int cmp5(int a)
-{
- return -3 < a;
-}
-
-int cmp6(int a)
-{
- return -3 > a;
-}
-
-int cmp7(int a)
-{
- return 3 < -a;
-}
-
-int cmp8(int a)
-{
- return 3 > -a;
-}
-
-int cmp9(int a, int b)
-{
- return -a < -b;
-}
-
-int cmp10(int a, int b)
-{
- return a-b == 0;
-}
-
-int cmp11(int a)
-{
- return a-3 != 5;
-}
-
-int cmp12(int a)
-{
- return a+3 == 5;
-}
-
-int cmp13(int a)
-{
- if (a < 0)
- return -a;
- else
- return a;
-}
-
-int cmp14(int a)
-{
- return a == 0 ? a : -a;
-}
-
-int cmp15(int a)
-{
- return a > 0;
-}
-
-int cmp16(int a)
-{
- return a < 0 ? -1 : 0;
-}
-
-int cmp17(int a, int b)
-{
- if (a < b)
- return a;
- return b;
-}
-
-int cmp18(int a, int b)
-{
- if (a > b)
- return a;
- return b;
-}
-
-double dcmp1(double a, double b) {
- if (a < b)
- return a;
- else
- return b;
-}
-
-double dcmp2(double a, double b) {
- if (a > b)
- return a;
- else
- return b;
-}
-
-int A = 1;
-int B = -1;
-double Fa = 200.;
-double Fb = 2;
-
-int main()
-{
- int a = A, b = B;
- double fa = Fa, fb = Fb;
-
- printf("cmp1(%d, %d) = %d\n", a, b, cmp1(a, b));
- printf("cmp2(%d, %d) = %d\n", a, b, cmp2(a, b));
- printf("cmp3(%d) = %d\n", a, cmp3(a));
- printf("cmp4(%d) = %d\n", a, cmp4(a));
- printf("cmp5(%d) = %d\n", a, cmp5(a));
- printf("cmp6(%d) = %d\n", a, cmp6(a));
- printf("cmp7(%d) = %d\n", a, cmp7(a));
- printf("cmp8(%d) = %d\n", a, cmp8(a));
- printf("cmp9(%d, %d) = %d\n", a, b, cmp9(a, b));
- printf("cmp10(%d, %d) = %d\n", a, b, cmp10(a, b));
- printf("cmp11(%d) = %d\n", a, cmp11(a));
- printf("cmp12(%d) = %d\n", a, cmp12(a));
- printf("cmp13(%d) = %d\n", a, cmp13(a));
- printf("cmp14(%d) = %d\n", a, cmp14(a));
- printf("cmp15(%d) = %d\n", a, cmp15(a));
- printf("cmp16(%d) = %d\n", a, cmp16(a));
- printf("cmp17(%d, %d) = %d\n", a, b, cmp18(a, b));
- printf("cmp18(%d, %d) = %d\n", a, b, cmp18(a, b));
-
- printf("dcmp1(%f, %f) = %f\n", -fa, -fb, dcmp1(-fa, -fb));
- printf("dcmp2(%f, %f) = %f\n", -fa, -fb, dcmp2(-fa, -fb));
- printf("dcmp1(%f, %f) = %f\n", fa, fb, dcmp1(fa, fb));
- printf("dcmp2(%f, %f) = %f\n", fa, fb, dcmp2(fa, fb));
-
- return 0;
-}
+++ /dev/null
-
-int sign(int x)
-{
- return (x > 5) - (x <= 5);
-}
-
-int main(void) {
- return 0;
-}
+++ /dev/null
-This directory contains some interesting chalenges for an x86 backend...
+++ /dev/null
-char *pt;
-
-int gf, gm;
-
-int f(int max) {
- int i;
- int f = 0;
- int m = 0;
- char *p = pt;
-
- for(i = 0; i < max; ++i) {
- if(pt[i] == 0) {
- f++;
- } else {
- m++;
- }
- }
- gf = f;
- gm = m;
- return 0;
-}
+++ /dev/null
-int first_ones[256];
-
- int FirstOne(unsigned long long arg1)
- {
- union doub {
- unsigned short i[4];
- unsigned long long d;
- };
- union doub x;
- x.d=arg1;
-
- if (x.i[3])
- return (first_ones[x.i[3]]);
- if (x.i[2])
- return (first_ones[x.i[2]]+16);
- if (x.i[1])
- return (first_ones[x.i[1]]+32);
- if (x.i[0])
- return (first_ones[x.i[0]]+48);
-
- return(64);
- }
+++ /dev/null
-
-#define SIZE 10000
-int arr1[SIZE];
-int arr2[SIZE];
-
-int main(int argc, char **argv)
-{
- int i;
- int iter;
- int iterations = 100;
-
- if(argc > 1)
- iterations = atoi(argv[1]);
-
- for(iter = 0; iter < iterations; ++iter) {
- for(i = 0; i < SIZE; ++i) {
- arr1[i] = arr2[i] + 23.5;
- }
- }
-
- return 0;
-}
+++ /dev/null
-int k, g, h;
-
-char *arr;
-
-enum e_block_types {CLB, OUTPAD, INPAD, IO, ILLEGAL};
-struct s_block {
- char *name;
- enum e_block_types type;
- int *nets;
- int x;
- int y;
-};
-
-extern struct s_block *block;
-extern int num_blocks;
-
-int my_rand(int max);
-
-int f(int x, int y, int z)
-{
- k = x;
- g = y;
- h = z;
- int b_from = my_rand(num_blocks - 1);
-
- while(block[b_from].type != CLB) {
- b_from = my_rand(num_blocks-1);
- }
- return 0;
-}
-
-int t2(int a) {
- return a*2 + 2;
-}
-
-int t3(int a) {
- return a*8 + 2;
-}
-
-int t4(int x, int y) {
- return x + y + y;
-}
+++ /dev/null
-#include <stdio.h>
-
-static char *block;
-
-int processblock(void)
-{
- int i;
- block[0] = 10;
- for(i = 0; i < 100; ++i) {
- block[i] += 5;
- }
-
- return 0;
-}
-
-/* just here so the block variable doesn't get optimized away... */
-void initblock(void)
-{
- block = malloc(100);
-}
-
-char* getme(void)
-{
- return block;
-}
+++ /dev/null
-int x;
-
-void f(int a, int b, char* p)
-{
- int y = x;
- do {
- *p++ = 0;
- } while (++a != b);
- rand();
- x = y;
-}
+++ /dev/null
-#include <stdio.h>
-
-static void __attribute__((noinline)) f(void)
-{
- /* firm spiller will probably spill %ebp which will result in 2 additional
- * copies; %ebx->%ebp before asm and %ebp->%ebx at the end */
- unsigned eax = 0;
- unsigned ebx;
- unsigned ecx;
- unsigned edx;
-
- asm("cpuid" : "+a" (eax), "=b" (ebx), "=c" (ecx), "=d" (edx));
-
- unsigned buf[] = { ebx, edx, ecx };
- printf("%.12s\n", (char const*)buf);
-}
-
-int main(void)
-{
- f();
- return 0;
-}
+++ /dev/null
-int max = 1000000;
-
-int printf(const char *str, ...);
-
-int main(int argc, char **argv) {
- int i;
- int i2;
- int val;
-
- for(i = 0; i < max; ++i) {
- val = rand();
- }
-
- rand();
- for(i2 = 0; i2 < 100; ++i2) {
- for(i = 0; i < max; ++i) {
- int i1 = rand();
- int i2 = rand();
- int i3 = rand();
- int i4 = rand();
- int i5 = rand();
- int i6 = rand();
- int i7 = rand();
-
- i += i1 +i2 +i3+i4+i5+i6+i7;
- printf("%d\n", i);
- }
- }
-
- printf("end\n");
- return val;
-}
+++ /dev/null
-volatile int G1, G2, G3, G4, G5;
-
-volatile int VG;
-
-static void __attribute__((noinline)) f(int k)
-{
- (void) k;
-}
-
-static void __attribute__((noinline)) test()
-{
- int foo = rand();
-
- // spill foo.
- int t1 = G1;
- int t2 = G2;
- int t3 = G3;
- int t4 = G4;
- int t5 = G5;
-
- int bar = rand();
- int i;
-
- G1 = t1; G2 = t2; G3 = t3; G4 = t4; G5 = t5;
- G1 = t1; G2 = t2; G3 = t3; G4 = t4; G5 = t5;
- G1 = t1; G2 = t2; G3 = t3; G4 = t4; G5 = t5;
-
- i = 10000;
- while (i--) {
- VG = foo; // really keep foo in a reg.
- f(bar); // bar live
- G1 = t1;
- VG = foo;
- G2 = t2;
- VG = foo;
- G3 = t3;
- VG = foo;
- G4 = t4;
- VG = foo;
- G5 = t5;
-
- }
-}
-
-int main(void)
-{
- int i;
-
- for(i = 0; i < 50000; ++i) {
- test();
- }
-}
+++ /dev/null
-
-struct bar {
- unsigned int size;
-};
-
-char *foo;
-
-void f(void)
-{
- foo += 5;
- ((struct bar*) (foo - 10))->size = 10;
- ((struct bar*) (foo - 10))->size += 1;
- ((struct bar*) (foo - 10))->size -= 1;
-}
+++ /dev/null
-/*$ -fcombo -fno-inline $*/
-int test(int a, int b) {
- int c, d;
-
- c = a + b;
-
- if (0)
- d = 0;
- else
- d = b;
-
- d = d + a;
-
- return c + d;
-}
-
-int main(int argc, char *argv[]) {
- return test(2,3) != 10;
-}
+++ /dev/null
-/* Verify that flexible arrays can be initialized from STRING_CST
- constructors. */
-
-/* The tests. */
-struct S3 {
- char a3c;
- char a3p[];
-} a3 = {
- 'o',
- "wx"
-};
-
-main()
-{
- if (a3.a3c != 'o')
- abort();
- if (a3.a3p[0] != 'w')
- abort();
- if (a3.a3p[1] != 'x')
- abort();
-
- return 0;
-}
+++ /dev/null
-/* Macros to emit "L Nxx R" for each octal number xx between 000 and 037. */
-#define OP1(L, N, R, I, J) L N##I##J R
-#define OP2(L, N, R, I) \
- OP1(L, N, R, 0, I), OP1(L, N, R, 1, I), \
- OP1(L, N, R, 2, I), OP1(L, N, R, 3, I)
-#define OP(L, N, R) \
- OP2(L, N, R, 0), OP2(L, N, R, 1), OP2(L, N, R, 2), OP2(L, N, R, 3), \
- OP2(L, N, R, 4), OP2(L, N, R, 5), OP2(L, N, R, 6), OP2(L, N, R, 7)
-
-/* Declare 32 unique variables with prefix N. */
-#define DECLARE(N) OP (, N,)
-
-/* Copy 32 variables with prefix N from the array at ADDR.
- Leave ADDR pointing to the end of the array. */
-#define COPYIN(N, ADDR) OP (, N, = *(ADDR++))
-
-/* Likewise, but copy the other way. */
-#define COPYOUT(N, ADDR) OP (*(ADDR++) =, N,)
-
-/* Add the contents of the array at ADDR to 32 variables with prefix N.
- Leave ADDR pointing to the end of the array. */
-#define ADD(N, ADDR) OP (, N, += *(ADDR++))
-
-volatile double gd[32];
-volatile float gf[32];
-
-void foo (int n)
-{
- double DECLARE(d);
- float DECLARE(f);
- volatile double *pd;
- volatile float *pf;
- int i;
-
- pd = gd; COPYIN (d, pd);
- for (i = 0; i < n; i++)
- {
- pf = gf; COPYIN (f, pf);
- pd = gd; ADD (d, pd);
- pd = gd; ADD (d, pd);
- pd = gd; ADD (d, pd);
- pf = gf; COPYOUT (f, pf);
- }
- pd = gd; COPYOUT (d, pd);
-}
-
-int main ()
-{
- int i;
-
- for (i = 0; i < 32; i++) {
- gd[i] = i, gf[i] = i;
- }
-
- foo (1);
-
- for (i = 0; i < 32; i++) {
- if(gf[i] != i) {
- printf("abort1 (%d) expected %d, got %f\n", i, i, gf[i]);
- abort();
- }
- if (gd[i] != i * 4) {
- printf("abort2 (%d) expected %d, got %f\n", i, i*4, gd[i]);
- abort ();
- }
- }
-
- exit (0);
-}
+++ /dev/null
-#include <stdio.h>
-#include <stdlib.h>
-
-/* Test arithmetics on bitfields. */
-
-extern void abort (void);
-extern void exit (int);
-
-unsigned int
-myrnd (void)
-{
- static unsigned int s = 1388815473;
- s *= 1103515245;
- s += 12345;
- return (s / 65536) % 2048;
-}
-
-#define T(S) \
-struct S s##S; \
-struct S retme##S (struct S x) \
-{ \
- return x; \
-} \
- \
-unsigned int fn1##S (unsigned int x) \
-{ \
- struct S y = s##S; \
- y.k += x; \
- y = retme##S (y); \
- return y.k; \
-} \
- \
-unsigned int fn2##S (unsigned int x) \
-{ \
- struct S y = s##S; \
- y.k += x; \
- y.k %= 15; \
- return y.k; \
-} \
- \
-unsigned int retit##S (void) \
-{ \
- return s##S.k; \
-} \
- \
-unsigned int fn3##S (unsigned int x) \
-{ \
- s##S.k += x; \
- return retit##S (); \
-} \
- \
-void test##S (void) \
-{ \
- int i; \
- unsigned int mask, v, a, r; \
- struct S x; \
- char *p = (char *) &s##S; \
- for (i = 0; i < sizeof (s##S); ++i) \
- *p++ = myrnd (); \
- if (__builtin_classify_type (s##S.l) == 8) \
- s##S.l = 5.25; \
- s##S.k = -1; \
- mask = s##S.k; \
- v = myrnd (); \
- a = myrnd (); \
- s##S.k = v; \
- x = s##S; \
- r = fn1##S (a); \
- if (x.i != s##S.i || x.j != s##S.j \
- || x.k != s##S.k || x.l != s##S.l \
- || ((v + a) & mask) != r) { \
- printf("abort '%s' 1\n", #S ); \
- abort (); \
- } \
- v = myrnd (); \
- a = myrnd (); \
- s##S.k = v; \
- x = s##S; \
- r = fn2##S (a); \
- if (x.i != s##S.i || x.j != s##S.j \
- || x.k != s##S.k || x.l != s##S.l \
- || ((((v + a) & mask) % 15) & mask) != r) {\
- printf("abort '%s' 2\n", #S ); \
- abort (); \
- }\
- v = myrnd (); \
- a = myrnd (); \
- s##S.k = v; \
- x = s##S; \
- r = fn3##S (a); \
- if (x.i != s##S.i || x.j != s##S.j \
- || s##S.k != r || x.l != s##S.l \
- || ((v + a) & mask) != r) { \
- printf("abort '%s' 3\n", #S ); \
- abort (); \
- } \
-}
-
-#ifdef __powerpc64__
-/* Temporary hack for broken PPC64 unaligned handling PR rtl-optimization/13674 */
-# define pck
-#else
-# define pck __attribute__((packed))
-#endif
-struct pck A { unsigned short i : 1, l : 1, j : 3, k : 11; }; T(A)
-struct pck B { unsigned short i : 4, j : 1, k : 11; unsigned int l; }; T(B)
-struct pck C { unsigned int l; unsigned short i : 4, j : 1, k : 11; }; T(C)
-struct pck D { unsigned long long l : 6, i : 6, j : 23, k : 29; }; T(D)
-struct pck E { unsigned long long l, i : 12, j : 23, k : 29; }; T(E)
-struct pck F { unsigned long long i : 12, j : 23, k : 29, l; }; T(F)
-struct pck G { unsigned short i : 1, j : 1, k : 6; unsigned long long l; }; T(G)
-struct pck H { unsigned short i : 6, j : 2, k : 8; unsigned long long l; }; T(H)
-struct pck I { unsigned short i : 1, j : 6, k : 1; unsigned long long l; }; T(I)
-struct pck J { unsigned short i : 1, j : 8, k : 7; unsigned short l; }; T(J)
-struct pck K { unsigned int k : 6, l : 1, j : 10, i : 15; }; T(K)
-struct pck L { unsigned int k : 6, j : 11, i : 15; unsigned int l; }; T(L)
-struct pck M { unsigned int l; unsigned short k : 6, j : 11, i : 15; }; T(M)
-struct pck N { unsigned long long l : 6, k : 6, j : 23, i : 29; }; T(N)
-struct pck O { unsigned long long l, k : 12, j : 23, i : 29; }; T(O)
-struct pck P { unsigned long long k : 12, j : 23, i : 29, l; }; T(P)
-struct pck Q { unsigned short k : 12, j : 1, i : 3; unsigned long long l; }; T(Q)
-struct pck R { unsigned short k : 2, j : 11, i : 3; unsigned long long l; }; T(R)
-struct pck S { unsigned short k : 1, j : 6, i : 9; unsigned long long l; }; T(S)
-struct pck T { unsigned short k : 1, j : 8, i : 7; unsigned short l; }; T(T)
-struct pck U { unsigned short j : 6, k : 1, i : 9; unsigned long long l; }; T(U)
-struct pck V { unsigned short j : 8, k : 1, i : 7; unsigned short l; }; T(V)
-struct pck W { long double l; unsigned int k : 12, j : 13, i : 7; }; T(W)
-struct pck X { unsigned int k : 12, j : 13, i : 7; long double l; }; T(X)
-struct pck Y { unsigned int k : 12, j : 11, i : 9; long double l; }; T(Y)
-struct pck Z { long double l; unsigned int j : 13, i : 7, k : 12; }; T(Z)
-
-int
-main (void)
-{
- testA ();
- testB ();
- testC ();
- testD ();
- testE ();
- testF ();
- testG ();
- testH ();
- testI ();
- testJ ();
- testK ();
- testL ();
- testM ();
- testN ();
- testO ();
- testP ();
- testQ ();
- testR ();
- testS ();
- testT ();
- testU ();
- testV ();
- testW ();
- testX ();
- testY ();
- testZ ();
- exit (0);
-}
+++ /dev/null
-#include <stdio.h>
-
-char* blup()
-{
- char* p = "all ok";
-
- if(0) {
- int i = 0;
- do {
- *--p = '0' - i % 10;
- } while((i /= 10) != 0);
-
- *--p = '-';
- }
-
- return p;
-}
-
-int main() {
- printf("result: %s\n", blup());
- return 0;
-}
+++ /dev/null
-/*
- * Compress - data compression program
- */
-#define min(a,b) ((a>b) ? b : a)
-
-
-/*
- * Set USERMEM to the maximum amount of physical user memory available
- * in bytes. USERMEM is used to determine the maximum BITS that can be used
- * for compression.
- *
- * SACREDMEM is the amount of physical memory saved for others; compress
- * will hog the rest.
- */
-/* For SPEC95 use, SACREDMEM automatically set to 0.
- Jeff Reilly, 1/15/95 */
-
-#define SACREDMEM 0
-
-/* For SPEC95 use, USERMEM automatically set to 450000.
- Jeff Reilly, 1/15/95 */
-# define USERMEM 450000 /* default user memory */
-
-#ifdef interdata /* (Perkin-Elmer) */
-#define SIGNED_COMPARE_SLOW /* signed compare is slower than unsigned */
-#endif
-
-/* For SPEC95 use, PBITS and BITS automatically set to 16.
- Jeff Reilyy, 1/15/95 */
-#define PBITS 16
-#define BITS 16
-#define HSIZE 69001 /* 95% occupancy */
-
-
-/*
- * a code_int must be able to hold 2**BITS values of type int, and also -1
- */
-#if BITS > 15
-typedef long int code_int;
-#else
-typedef int code_int;
-#endif
-
-#ifdef SIGNED_COMPARE_SLOW
-typedef unsigned long int count_int;
-typedef unsigned short int count_short;
-#else
-typedef long int count_int;
-#endif
-
-#ifdef NO_UCHAR
- typedef char char_type;
-#else
- typedef unsigned char char_type;
-#endif /* UCHAR */
-char_type magic_header[] = { "\037\235" }; /* 1F 9D */
-
-/* Defines for third byte of header */
-#define BIT_MASK 0x1f
-#define BLOCK_MASK 0x80
-/* Masks 0x40 and 0x20 are free. I think 0x20 should mean that there is
- a fourth header byte (for expansion).
-*/
-#define INIT_BITS 9 /* initial number of bits/code */
-
-/* SPEC95, Original comments left - Jeff Reilly, 1/18/95 */
-/*
- * compress.c - File compression ala IEEE Computer, June 1984.
- *
- * Authors: Spencer W. Thomas (decvax!harpo!utah-cs!utah-gr!thomas)
- * Jim McKie (decvax!mcvax!jim)
- * Steve Davies (decvax!vax135!petsd!peora!srd)
- * Ken Turkowski (decvax!decwrl!turtlevax!ken)
- * James A. Woods (decvax!ihnp4!ames!jaw)
- * Joe Orost (decvax!vax135!petsd!joe)
- *
- * $Header$
- * $Log$
- * Revision 1.2 2006/07/08 10:06:28 matze
- * fixed some more testapps
- *
- * Revision 1.1 2006/03/17 14:47:52 chriswue
- * added addtional test file
- *
- * Revision 1.3 90/07/18 20:22:34 mips
- * a few small changes for VMS, all of the ifdef VAX is gone.
- *
- * Revision 1.1 90/07/12 10:58:29 10:58:29 root ()
- * Initial revision
- *
- * Revision 4.0 85/07/30 12:50:00 joe
- * Removed ferror() calls in output routine on every output except first.
- * Prepared for release to the world.
- *
- * Revision 3.6 85/07/04 01:22:21 joe
- * Remove much wasted storage by overlaying hash table with the tables
- * used by decompress: tab_suffix[1<<BITS], stack[8000]. Updated USERMEM
- * computations. Fixed dump_tab() DEBUG routine.
- *
- * Revision 3.5 85/06/30 20:47:21 jaw
- * Change hash function to use exclusive-or. Rip out hash cache. These
- * speedups render the megamemory version defunct, for now. Make decoder
- * stack global. Parts of the RCS trunks 2.7, 2.6, and 2.1 no longer apply.
- *
- * Revision 3.4 85/06/27 12:00:00 ken
- * Get rid of all floating-point calculations by doing all compression ratio
- * calculations in fixed point.
- *
- * Revision 3.3 85/06/24 21:53:24 joe
- * Incorporate portability suggestion for M_XENIX. Got rid of text on #else
- * and #endif lines. Cleaned up #ifdefs for vax and interdata.
- *
- * Revision 3.2 85/06/06 21:53:24 jaw
- * Incorporate portability suggestions for Z8000, IBM PC/XT from mailing list.
- * Default to "quiet" output (no compression statistics).
- *
- * Revision 3.1 85/05/12 18:56:13 jaw
- * Integrate decompress() stack speedups (from early pointer mods by McKie).
- * Repair multi-file USERMEM gaffe. Unify 'force' flags to mimic semantics
- * of SVR2 'pack'. Streamline block-compress table clear logic. Increase
- * output byte count by magic number size.
- *
- * Revision 3.0 84/11/27 11:50:00 petsd!joe
- * Set HSIZE depending on BITS. Set BITS depending on USERMEM. Unrolled
- * loops in clear routines. Added "-C" flag for 2.0 compatibility. Used
- * unsigned compares on Perkin-Elmer. Fixed foreground check.
- *
- * Revision 2.7 84/11/16 19:35:39 ames!jaw
- * Cache common hash codes based on input statistics; this improves
- * performance for low-density raster images. Pass on #ifdef bundle
- * from Turkowski.
- *
- * Revision 2.6 84/11/05 19:18:21 ames!jaw
- * Vary size of hash tables to reduce time for small files.
- * Tune PDP-11 hash function.
- *
- * Revision 2.5 84/10/30 20:15:14 ames!jaw
- * Junk chaining; replace with the simpler (and, on the VAX, faster)
- * double hashing, discussed within. Make block compression standard.
- *
- * Revision 2.4 84/10/16 11:11:11 ames!jaw
- * Introduce adaptive reset for block compression, to boost the rate
- * another several percent. (See mailing list notes.)
- *
- * Revision 2.3 84/09/22 22:00:00 petsd!joe
- * Implemented "-B" block compress. Implemented REVERSE sorting of tab_next.
- * Bug fix for last bits. Changed fwrite to putchar loop everywhere.
- *
- * Revision 2.2 84/09/18 14:12:21 ames!jaw
- * Fold in news changes, small machine typedef from thomas,
- * #ifdef interdata from joe.
- *
- * Revision 2.1 84/09/10 12:34:56 ames!jaw
- * Configured fast table lookup for 32-bit machines.
- * This cuts user time in half for b <= FBITS, and is useful for news batching
- * from VAX to PDP sites. Also sped up decompress() [fwrite->putc] and
- * added signal catcher [plus beef in writeerr()] to delete effluvia.
- *
- * Revision 2.0 84/08/28 22:00:00 petsd!joe
- * Add check for foreground before prompting user. Insert maxbits into
- * compressed file. Force file being uncompressed to end with ".Z".
- * Added "-c" flag and "zcat". Prepared for release.
- *
- * Revision 1.10 84/08/24 18:28:00 turtlevax!ken
- * Will only compress regular files (no directories), added a magic number
- * header (plus an undocumented -n flag to handle old files without headers),
- * added -f flag to force overwriting of possibly existing destination file,
- * otherwise the user is prompted for a response. Will tack on a .Z to a
- * filename if it doesn't have one when decompressing. Will only replace
- * file if it was compressed.
- *
- * Revision 1.9 84/08/16 17:28:00 turtlevax!ken
- * Removed scanargs(), getopt(), added .Z extension and unlimited number of
- * filenames to compress. Flags may be clustered (-Ddvb12) or separated
- * (-D -d -v -b 12), or combination thereof. Modes and other status is
- * copied with copystat(). -O bug for 4.2 seems to have disappeared with
- * 1.8.
- *
- * Revision 1.8 84/08/09 23:15:00 joe
- * Made it compatible with vax version, installed jim's fixes/enhancements
- *
- * Revision 1.6 84/08/01 22:08:00 joe
- * Sped up algorithm significantly by sorting the compress chain.
- *
- * Revision 1.5 84/07/13 13:11:00 srd
- * Added C version of vax asm routines. Changed structure to arrays to
- * save much memory. Do unsigned compares where possible (faster on
- * Perkin-Elmer)
- *
- * Revision 1.4 84/07/05 03:11:11 thomas
- * Clean up the code a little and lint it. (Lint complains about all
- * the regs used in the asm, but I'm not going to "fix" this.)
- *
- * Revision 1.3 84/07/05 02:06:54 thomas
- * Minor fixes.
- *
- * Revision 1.2 84/07/05 00:27:27 thomas
- * Add variable bit length output.
- *
- */
-static char rcs_ident[] = "$Header$";
-
-#include <stdio.h>
-#include <ctype.h>
-#include <stdlib.h>
-#ifdef VMS
-#include <types.h>
-#include <stat.h>
-#define unlink delete
-#else
-#include <sys/types.h>
-#include <sys/stat.h>
-#endif /* VMS */
-
-#define ARGVAL() (*++(*argv) || (--argc && *++argv))
-
-int n_bits; /* number of bits/code */
-int maxbits = BITS; /* user settable max # bits/code */
-code_int maxcode; /* maximum code, given n_bits */
-code_int maxmaxcode = 1 << BITS; /* should NEVER generate this code */
-#ifdef COMPATIBLE /* But wrong! */
-# define MAXCODE(n_bits) (1 << (n_bits) - 1)
-#else
-# define MAXCODE(n_bits) ((1 << (n_bits)) - 1)
-#endif /* COMPATIBLE */
-
-#ifdef XENIX_16
-count_int htab0[8192];
-count_int htab1[8192];
-count_int htab2[8192];
-count_int htab3[8192];
-count_int htab4[8192];
-count_int htab5[8192];
-count_int htab6[8192];
-count_int htab7[8192];
-count_int htab8[HSIZE-65536];
-count_int * htab[9] = {
- htab0, htab1, htab2, htab3, htab4, htab5, htab6, htab7, htab8 };
-
-#define htabof(i) (htab[(i) >> 13][(i) & 0x1fff])
-unsigned short code0tab[16384];
-unsigned short code1tab[16384];
-unsigned short code2tab[16384];
-unsigned short code3tab[16384];
-unsigned short code4tab[16384];
-unsigned short * codetab[5] = {
- code0tab, code1tab, code2tab, code3tab, code4tab };
-
-#define codetabof(i) (codetab[(i) >> 14][(i) & 0x3fff])
-
-#else /* Normal machine */
-count_int htab [HSIZE];
-unsigned short codetab [HSIZE];
-#define htabof(i) htab[i]
-#define codetabof(i) codetab[i]
-#endif /* XENIX_16 */
-code_int hsize = HSIZE; /* for dynamic table sizing */
-count_int fsize;
-
-/*
- * To save much memory, we overlay the table used by compress() with those
- * used by decompress(). The tab_prefix table is the same size and type
- * as the codetab. The tab_suffix table needs 2**BITS characters. We
- * get this from the beginning of htab. The output stack uses the rest
- * of htab, and contains characters. There is plenty of room for any
- * possible stack (stack used to be 8000 characters).
- */
-
-#define tab_prefixof(i) codetabof(i)
-#ifdef XENIX_16
-# define tab_suffixof(i) ((char_type *)htab[(i)>>15])[(i) & 0x7fff]
-# define de_stack ((char_type *)(htab2))
-#else /* Normal machine */
-# define tab_suffixof(i) ((char_type *)(htab))[i]
-# define de_stack ((char_type *)&tab_suffixof(1<<BITS))
-#endif /* XENIX_16 */
-
-code_int free_ent = 0; /* first unused entry */
-int exit_stat = 0;
-
-code_int getcode();
-
-int nomagic = 0; /* Use a 3-byte magic number header, unless old file */
-int zcat_flg = 0; /* Write output on stdout, suppress messages */
-int quiet = 1; /* don't tell me about compression */
-
-/*
- * block compression parameters -- after all codes are used up,
- * and compression rate changes, start over.
- */
-int block_compress = BLOCK_MASK;
-int clear_flg = 0;
-long int ratio = 0;
-#define CHECK_GAP 10000 /* ratio check interval */
-count_int checkpoint = CHECK_GAP;
-/*
- * the next two codes should not be changed lightly, as they must not
- * lie within the contiguous general code space.
- */
-#define FIRST 257 /* first free entry */
-#define CLEAR 256 /* table clear output code */
-
-int force = 0;
-char ofname [100];
-#ifdef DEBUG
-int verbose = 0;
-#endif /* DEBUG */
-
-int do_decomp = 0;
-
-
-int InCnt;
-unsigned char *InBuff;
-unsigned char *OutBuff;
-
-/*****************************************************************
- * TAG( main )
- *
- * Algorithm from "A Technique for High Performance Data Compression",
- * Terry A. Welch, IEEE Computer Vol 17, No 6 (June 1984), pp 8-19.
- *
- * Usage: compress [-dfvc] [-b bits] [file ...]
- * Inputs:
- * -d: If given, decompression is done instead.
- *
- * -c: Write output on stdout, don't remove original.
- *
- * -b: Parameter limits the max number of bits/code.
- *
- * -f: Forces output file to be generated, even if one already
- * exists, and even if no space is saved by compressing.
- * If -f is not used, the user will be prompted if stdin is
- * a tty, otherwise, the output file will not be overwritten.
- *
- * -v: Write compression statistics
- *
- * file ...: Files to be compressed. If none specified, stdin
- * is used.
- * Outputs:
- * file.Z: Compressed form of file with same mode, owner, and utimes
- * or stdout (if stdin used as input)
- *
- * Assumptions:
- * When filenames are given, replaces with the compressed version
- * (.Z suffix) only if the file decreases in size.
- * Algorithm:
- * Modified Lempel-Ziv method (LZW). Basically finds common
- * substrings and replaces them with a variable size code. This is
- * deterministic, and can be done on the fly. Thus, the decompression
- * procedure needs no input table, but tracks the way the table was built.
- *
- *
- * Changed from main to spec_select_action,
- * Jeff Reilly - 1/15/95 SPEC
- */
-
-spec_select_action(char* from_buf, int from_count, int action, char* to_buf)
-{
- char *rindex();
-#ifdef SYSV
- void onintr(), oops();
-#else
- int onintr(), oops();
-#endif /* SYSV */
-
-
-
-#ifdef COMPATIBLE
- nomagic = 1; /* Original didn't have a magic number */
-#endif /* COMPATIBLE */
-
-
- if(maxbits < INIT_BITS) maxbits = INIT_BITS;
- if (maxbits > BITS) maxbits = BITS;
- maxmaxcode = 1 << maxbits;
-
- InCnt = from_count;
- InBuff = (unsigned char *)from_buf;
- OutBuff = (unsigned char *)to_buf;
- do_decomp = action;
-
- if (do_decomp == 0) {
- compress();
-#ifdef DEBUG
- if(verbose) dump_tab();
-#endif /* DEBUG */
- } else {
- /* Check the magic number */
- if (nomagic == 0) {
- if ((getbyte() != (magic_header[0] & 0xFF))
- || (getbyte() != (magic_header[1] & 0xFF))) {
- fprintf(stderr, "stdin: not in compressed format\n");
- exit(1);
- }
- maxbits = getbyte(); /* set -b from file */
- block_compress = maxbits & BLOCK_MASK;
- maxbits &= BIT_MASK;
- maxmaxcode = 1 << maxbits;
- fsize = 100000; /* assume stdin large for USERMEM */
- if(maxbits > BITS) {
- fprintf(stderr,
- "stdin: compressed with %d bits, can only handle %d bits\n",
- maxbits, BITS);
- exit(1);
- }
- }
-#ifndef DEBUG
- decompress();
-#else
- if (debug == 0) decompress();
- else printcodes();
- if (verbose) dump_tab();
-#endif /* DEBUG */
- }
-
- return( OutBuff - (unsigned char *)to_buf );
-}
-
-static int offset;
-long int in_count = 1; /* length of input */
-long int bytes_out; /* length of compressed output */
-long int out_count = 0; /* # of codes output (for debugging) */
-
-/*
- * compress (Originally: stdin to stdout -- Changed by SPEC to: memory to memory)
- *
- * Algorithm: use open addressing double hashing (no chaining) on the
- * prefix code / next character combination. We do a variant of Knuth's
- * algorithm D (vol. 3, sec. 6.4) along with G. Knott's relatively-prime
- * secondary probe. Here, the modular division first probe is gives way
- * to a faster exclusive-or manipulation. Also do block compression with
- * an adaptive reset, whereby the code table is cleared when the compression
- * ratio decreases, but after the table fills. The variable-length output
- * codes are re-sized at this point, and a special CLEAR code is generated
- * for the decompressor. Late addition: construct the table according to
- * file size for noticeable speed improvement on small files. Please direct
- * questions about this implementation to ames!jaw.
- */
-
-compress() {
- register long fcode;
- register code_int i = 0;
- register int c;
- register code_int ent;
-#ifdef XENIX_16
- register code_int disp;
-#else /* Normal machine */
- register int disp;
-#endif
- register code_int hsize_reg;
- register int hshift;
-
-#ifndef COMPATIBLE
- if (nomagic == 0) {
- putbyte(magic_header[0]); putbyte(magic_header[1]);
- putbyte((char)(maxbits | block_compress));
- }
-#endif /* COMPATIBLE */
-
- offset = 0;
- bytes_out = 3; /* includes 3-byte header mojo */
- out_count = 0;
- clear_flg = 0;
- ratio = 0;
- in_count = 1;
- checkpoint = CHECK_GAP;
- maxcode = MAXCODE(n_bits = INIT_BITS);
- free_ent = ((block_compress) ? FIRST : 256 );
-
- ent = getbyte ();
-
- hshift = 0;
- for ( fcode = (long) hsize; fcode < 65536L; fcode *= 2L )
- hshift++;
- hshift = 8 - hshift; /* set hash code range bound */
-
- hsize_reg = hsize;
- cl_hash( (count_int) hsize_reg); /* clear hash table */
-
-#ifdef SIGNED_COMPARE_SLOW
- while ( (c = getbyte()) != (unsigned) EOF ) {
-#else
- while ( (c = getbyte()) != EOF ) {
-#endif
- in_count++;
- fcode = (long) (((long) c << maxbits) + ent);
- i = ((c << hshift) ^ ent); /* xor hashing */
-
- if ( htabof (i) == fcode ) {
- ent = codetabof (i);
- continue;
- } else if ( (long)htabof (i) < 0 ) /* empty slot */
- goto nomatch;
- disp = hsize_reg - i; /* secondary hash (after G. Knott) */
- if ( i == 0 )
- disp = 1;
-probe:
- if ( (i -= disp) < 0 )
- i += hsize_reg;
-
- if ( htabof (i) == fcode ) {
- ent = codetabof (i);
- continue;
- }
- if ( (long)htabof (i) > 0 )
- goto probe;
-nomatch:
- output ( (code_int) ent );
- out_count++;
- ent = c;
-#ifdef SIGNED_COMPARE_SLOW
- if ( (unsigned) free_ent < (unsigned) maxmaxcode) {
-#else
- if ( free_ent < maxmaxcode ) {
-#endif
- codetabof (i) = free_ent++; /* code -> hashtable */
- htabof (i) = fcode;
- }
- else if ( (count_int)in_count >= checkpoint && block_compress )
- cl_block ();
- }
- /*
- * Put out the final code.
- */
- output( (code_int)ent );
- out_count++;
- output( (code_int)-1 );
-
- /*
- * Print out stats on stderr
- */
- if(zcat_flg == 0 && !quiet) {
-#ifdef DEBUG
- fprintf( stderr,
- "%ld chars in, %ld codes (%ld bytes) out, compression factor: ",
- in_count, out_count, bytes_out );
- prratio( stderr, in_count, bytes_out );
- fprintf( stderr, "\n");
- fprintf( stderr, "\tCompression as in compact: " );
- prratio( stderr, in_count-bytes_out, in_count );
- fprintf( stderr, "\n");
- fprintf( stderr, "\tLargest code (of last block) was %d (%d bits)\n",
- free_ent - 1, n_bits );
-#else /* !DEBUG */
- fprintf( stderr, "Compression: " );
- prratio( stderr, in_count-bytes_out, in_count );
-#endif /* DEBUG */
- }
- if(bytes_out > in_count) /* exit(2) if no savings */
- exit_stat = 2;
- return;
-}
-
-/*****************************************************************
- * TAG( output )
- *
- * Output the given code.
- * Inputs:
- * code: A n_bits-bit integer. If == -1, then EOF. This assumes
- * that n_bits =< (long)wordsize - 1.
- * Outputs:
- * Outputs code to the file.
- * Assumptions:
- * Chars are 8 bits long.
- * Algorithm:
- * Maintain a BITS character long buffer (so that 8 codes will
- * fit in it exactly). Use the VAX insv instruction to insert each
- * code in turn. When the buffer fills up empty it and start over.
- */
-
-static char buf[BITS];
-
-char_type lmask[9] = {0xff, 0xfe, 0xfc, 0xf8, 0xf0, 0xe0, 0xc0, 0x80, 0x00};
-char_type rmask[9] = {0x00, 0x01, 0x03, 0x07, 0x0f, 0x1f, 0x3f, 0x7f, 0xff};
-
-output( code )
-code_int code;
-{
-#ifdef DEBUG
- static int col = 0;
-#endif /* DEBUG */
-
- /*
- * On the VAX, it is important to have the register declarations
- * in exactly the order given, or the asm will break.
- */
- register int r_off = offset, bits= n_bits;
- register char * bp = buf;
-
-#ifdef DEBUG
- if ( verbose )
- fprintf( stderr, "%5d%c", code,
- (col+=6) >= 74 ? (col = 0, '\n') : ' ' );
-#endif /* DEBUG */
- if ( code >= 0 ) {
-/*
- * byte/bit numbering on the VAX is simulated by the following code
- */
- /*
- * Get to the first byte.
- */
- bp += (r_off >> 3);
- r_off &= 7;
- /*
- * Since code is always >= 8 bits, only need to mask the first
- * hunk on the left.
- */
- *bp = (*bp & rmask[r_off]) | (code << r_off) & lmask[r_off];
- bp++;
- bits -= (8 - r_off);
- code >>= 8 - r_off;
- /* Get any 8 bit parts in the middle (<=1 for up to 16 bits). */
- if ( bits >= 8 ) {
- *bp++ = code;
- code >>= 8;
- bits -= 8;
- }
- /* Last bits. */
- if(bits)
- *bp = code;
- offset += n_bits;
- if ( offset == (n_bits << 3) ) {
- bp = buf;
- bits = n_bits;
- bytes_out += bits;
- do
- putbyte(*bp++);
- while(--bits);
- offset = 0;
- }
-
- /*
- * If the next entry is going to be too big for the code size,
- * then increase it, if possible.
- */
- if ( free_ent > maxcode || (clear_flg > 0))
- {
- /*
- * Write the whole buffer, because the input side won't
- * discover the size increase until after it has read it.
- */
- if ( offset > 0 ) {
- writebytes( buf, n_bits );
- bytes_out += n_bits;
- }
- offset = 0;
-
- if ( clear_flg ) {
- maxcode = MAXCODE (n_bits = INIT_BITS);
- clear_flg = 0;
- }
- else {
- n_bits++;
- if ( n_bits == maxbits )
- maxcode = maxmaxcode;
- else
- maxcode = MAXCODE(n_bits);
- }
-#ifdef DEBUG
- if ( debug ) {
- fprintf( stderr, "\nChange to %d bits\n", n_bits );
- col = 0;
- }
-#endif /* DEBUG */
- }
- } else {
- /*
- * At EOF, write the rest of the buffer.
- */
- if ( offset > 0 )
- writebytes( buf, ((offset + 7) / 8) );
- bytes_out += (offset + 7) / 8;
- offset = 0;
-#ifdef DEBUG
- if ( verbose )
- fprintf( stderr, "\n" );
-#endif /* DEBUG */
- }
-}
-
-/*
- * Decompress stdin to stdout. This routine adapts to the codes in the
- * file building the "string" table on-the-fly; requiring no table to
- * be stored in the compressed file. The tables used herein are shared
- * with those of the compress() routine. See the definitions above.
- */
-
-decompress() {
- register char_type *stackp;
- register int finchar;
- register code_int code, oldcode, incode;
-
- /*
- * As above, initialize the first 256 entries in the table.
- */
- maxcode = MAXCODE(n_bits = INIT_BITS);
- for ( code = 255; code >= 0; code-- ) {
- tab_prefixof(code) = 0;
- tab_suffixof(code) = (char_type)code;
- }
- free_ent = ((block_compress) ? FIRST : 256 );
-
- finchar = oldcode = getcode();
- if(oldcode == -1) /* EOF already? */
- return; /* Get out of here */
- putbyte( (char)finchar ); /* first code must be 8 bits = char */
- stackp = de_stack;
-
- while ( (code = getcode()) > -1 ) {
-
- if ( (code == CLEAR) && block_compress ) {
- for ( code = 255; code >= 0; code-- )
- tab_prefixof(code) = 0;
- clear_flg = 1;
- free_ent = FIRST - 1;
- if ( (code = getcode ()) == -1 ) /* O, untimely death! */
- break;
- }
- incode = code;
- /*
- * Special case for KwKwK string.
- */
- if ( code >= free_ent ) {
- *stackp++ = finchar;
- code = oldcode;
- }
-
- /*
- * Generate output characters in reverse order
- */
-#ifdef SIGNED_COMPARE_SLOW
- while ( ((unsigned long)code) >= ((unsigned long)256) ) {
-#else
- while ( code >= 256 ) {
-#endif
- *stackp++ = tab_suffixof(code);
- code = tab_prefixof(code);
- }
- *stackp++ = finchar = tab_suffixof(code);
-
- /*
- * And put them out in forward order
- */
- do
- putbyte ( *--stackp );
- while ( stackp > de_stack );
-
- /*
- * Generate the new entry.
- */
- if ( (code=free_ent) < maxmaxcode ) {
- tab_prefixof(code) = (unsigned short)oldcode;
- tab_suffixof(code) = finchar;
- free_ent = code+1;
- }
- /*
- * Remember previous code.
- */
- oldcode = incode;
- }
-}
-
-/*****************************************************************
- * TAG( getcode )
- *
- * Read one code from the standard input. If EOF, return -1.
- * Inputs:
- * stdin
- * Outputs:
- * code or -1 is returned.
- */
-
-code_int
-getcode() {
- /*
- * On the VAX, it is important to have the register declarations
- * in exactly the order given, or the asm will break.
- */
- register code_int code;
- static int offset = 0, size = 0;
- static char_type buf[BITS];
- register int r_off, bits;
- register char_type *bp = buf;
-
- if ( clear_flg > 0 || offset >= size || free_ent > maxcode ) {
- /*
- * If the next entry will be too big for the current code
- * size, then we must increase the size. This implies reading
- * a new buffer full, too.
- */
- if ( free_ent > maxcode ) {
- n_bits++;
- if ( n_bits == maxbits )
- maxcode = maxmaxcode; /* won't get any bigger now */
- else
- maxcode = MAXCODE(n_bits);
- }
- if ( clear_flg > 0) {
- maxcode = MAXCODE (n_bits = INIT_BITS);
- clear_flg = 0;
- }
- size = readbytes( buf, n_bits );
- if ( size <= 0 )
- return -1; /* end of file */
- offset = 0;
- /* Round size down to integral number of codes */
- size = (size << 3) - (n_bits - 1);
- }
- r_off = offset;
- bits = n_bits;
- /*
- * Get to the first byte.
- */
- bp += (r_off >> 3);
- r_off &= 7;
- /* Get first part (low order bits) */
-#ifdef NO_UCHAR
- code = ((*bp++ >> r_off) & rmask[8 - r_off]) & 0xff;
-#else
- code = (*bp++ >> r_off);
-#endif /* NO_UCHAR */
- bits -= (8 - r_off);
- r_off = 8 - r_off; /* now, offset into code word */
- /* Get any 8 bit parts in the middle (<=1 for up to 16 bits). */
- if ( bits >= 8 ) {
-#ifdef NO_UCHAR
- code |= (*bp++ & 0xff) << r_off;
-#else
- code |= *bp++ << r_off;
-#endif /* NO_UCHAR */
- r_off += 8;
- bits -= 8;
- }
- /* high order bits. */
- code |= (*bp & rmask[bits]) << r_off;
- offset += n_bits;
-
- return code;
-}
-
-char *
-rindex(s, c) /* For those who don't have it in libc.a */
-register char *s, c;
-{
- char *p;
- for (p = NULL; *s; s++)
- if (*s == c)
- p = s;
- return(p);
-}
-
-#ifdef DEBUG
-printcodes()
-{
- /*
- * Just print out codes from input file. For debugging.
- */
- code_int code;
- int col = 0, bits;
-
- bits = n_bits = INIT_BITS;
- maxcode = MAXCODE(n_bits);
- free_ent = ((block_compress) ? FIRST : 256 );
- while ( ( code = getcode() ) >= 0 ) {
- if ( (code == CLEAR) && block_compress ) {
- free_ent = FIRST - 1;
- clear_flg = 1;
- }
- else if ( free_ent < maxmaxcode )
- free_ent++;
- if ( bits != n_bits ) {
- fprintf(stderr, "\nChange to %d bits\n", n_bits );
- bits = n_bits;
- col = 0;
- }
- fprintf(stderr, "%5d%c", code, (col+=6) >= 74 ? (col = 0, '\n') : ' ' );
- }
- putc( '\n', stderr );
- exit( 0 );
-}
-
-code_int sorttab[1<<BITS]; /* sorted pointers into htab */
-
-dump_tab() /* dump string table */
-{
- register int i, first;
- register ent;
-#define STACK_SIZE 15000
- int stack_top = STACK_SIZE;
- register c;
-
- if(do_decomp == 0) { /* compressing */
- register int flag = 1;
-
- for(i=0; i<hsize; i++) { /* build sort pointers */
- if((long)htabof(i) >= 0) {
- sorttab[codetabof(i)] = i;
- }
- }
- first = block_compress ? FIRST : 256;
- for(i = first; i < free_ent; i++) {
- fprintf(stderr, "%5d: \"", i);
- de_stack[--stack_top] = '\n';
- de_stack[--stack_top] = '"';
- stack_top = in_stack((htabof(sorttab[i])>>maxbits)&0xff,
- stack_top);
- for(ent=htabof(sorttab[i]) & ((1<<maxbits)-1);
- ent > 256;
- ent=htabof(sorttab[ent]) & ((1<<maxbits)-1)) {
- stack_top = in_stack(htabof(sorttab[ent]) >> maxbits,
- stack_top);
- }
- stack_top = in_stack(ent, stack_top);
- fwrite( &de_stack[stack_top], 1, STACK_SIZE-stack_top, stderr);
- stack_top = STACK_SIZE;
- }
- } else if(!debug) { /* decompressing */
-
- for ( i = 0; i < free_ent; i++ ) {
- ent = i;
- c = tab_suffixof(ent);
- if ( isascii(c) && isprint(c) )
- fprintf( stderr, "%5d: %5d/'%c' \"",
- ent, tab_prefixof(ent), c );
- else
- fprintf( stderr, "%5d: %5d/\\%03o \"",
- ent, tab_prefixof(ent), c );
- de_stack[--stack_top] = '\n';
- de_stack[--stack_top] = '"';
- for ( ; ent != NULL;
- ent = (ent >= FIRST ? tab_prefixof(ent) : NULL) ) {
- stack_top = in_stack(tab_suffixof(ent), stack_top);
- }
- fwrite( &de_stack[stack_top], 1, STACK_SIZE - stack_top, stderr );
- stack_top = STACK_SIZE;
- }
- }
-}
-
-int
-in_stack(c, stack_top)
- register c, stack_top;
-{
- if ( (isascii(c) && isprint(c) && c != '\\') || c == ' ' ) {
- de_stack[--stack_top] = c;
- } else {
- switch( c ) {
- case '\n': de_stack[--stack_top] = 'n'; break;
- case '\t': de_stack[--stack_top] = 't'; break;
- case '\b': de_stack[--stack_top] = 'b'; break;
- case '\f': de_stack[--stack_top] = 'f'; break;
- case '\r': de_stack[--stack_top] = 'r'; break;
- case '\\': de_stack[--stack_top] = '\\'; break;
- default:
- de_stack[--stack_top] = '0' + c % 8;
- de_stack[--stack_top] = '0' + (c / 8) % 8;
- de_stack[--stack_top] = '0' + c / 64;
- break;
- }
- de_stack[--stack_top] = '\\';
- }
- return stack_top;
-}
-#endif /* DEBUG */
-
-
-#ifdef SYSV
-void
-#endif /* SYSV */
-onintr ( )
-{
- unlink ( ofname );
- exit ( 1 );
-}
-
-#ifdef SYSV
-void
-#endif /* SYSV */
-oops ( ) /* wild pointer -- assume bad input */
-{
- if ( do_decomp == 1 )
- fprintf ( stderr, "uncompress: corrupt input\n" );
- unlink ( ofname );
- exit ( 1 );
-}
-
-cl_block () /* table clear for block compress */
-{
- register long int rat;
-
- checkpoint = in_count + CHECK_GAP;
-#ifdef DEBUG
- if ( debug ) {
- fprintf ( stderr, "count: %ld, ratio: ", in_count );
- prratio ( stderr, in_count, bytes_out );
- fprintf ( stderr, "\n");
- }
-#endif /* DEBUG */
-
- if(in_count > 0x007fffff) { /* shift will overflow */
- rat = bytes_out >> 8;
- if(rat == 0) { /* Don't divide by zero */
- rat = 0x7fffffff;
- } else {
- rat = in_count / rat;
- }
- } else {
- rat = (in_count << 8) / bytes_out; /* 8 fractional bits */
- }
- if ( rat > ratio ) {
- ratio = rat;
- } else {
- ratio = 0;
-#ifdef DEBUG
- if(verbose)
- dump_tab(); /* dump string table */
-#endif
- cl_hash ( (count_int) hsize );
- free_ent = FIRST;
- clear_flg = 1;
- output ( (code_int) CLEAR );
-#ifdef DEBUG
- if(debug)
- fprintf ( stderr, "clear\n" );
-#endif /* DEBUG */
- }
-}
-
-cl_hash(hsize) /* reset code table */
- register count_int hsize;
-{
-#ifndef XENIX_16 /* Normal machine */
- register count_int *htab_p = htab+hsize;
-#else
- register j;
- register long k = hsize;
- register count_int *htab_p;
-#endif
- register long i;
- register long m1 = -1;
-
-#ifdef XENIX_16
- for(j=0; j<=8 && k>=0; j++,k-=8192) {
- i = 8192;
- if(k < 8192) {
- i = k;
- }
- htab_p = &(htab[j][i]);
- i -= 16;
- if(i > 0) {
-#else
- i = hsize - 16;
-#endif
- do { /* might use Sys V memset(3) here */
- *(htab_p-16) = m1;
- *(htab_p-15) = m1;
- *(htab_p-14) = m1;
- *(htab_p-13) = m1;
- *(htab_p-12) = m1;
- *(htab_p-11) = m1;
- *(htab_p-10) = m1;
- *(htab_p-9) = m1;
- *(htab_p-8) = m1;
- *(htab_p-7) = m1;
- *(htab_p-6) = m1;
- *(htab_p-5) = m1;
- *(htab_p-4) = m1;
- *(htab_p-3) = m1;
- *(htab_p-2) = m1;
- *(htab_p-1) = m1;
- htab_p -= 16;
- } while ((i -= 16) >= 0);
-#ifdef XENIX_16
- }
- }
-#endif
- for ( i += 16; i > 0; i-- )
- *--htab_p = m1;
-}
-
-prratio(stream, num, den)
-FILE *stream;
-long int num, den;
-{
- register int q; /* Doesn't need to be long */
-
- if(num > 214748L) { /* 2147483647/10000 */
- q = num / (den / 10000L);
- } else {
- q = 10000L * num / den; /* Long calculations, though */
- }
- if (q < 0) {
- putc('-', stream);
- q = -q;
- }
- fprintf(stream, "%d.%02d%%", q / 100, q % 100);
-}
-
-version()
-{
- fprintf(stderr, "%s\n", rcs_ident);
- fprintf(stderr, "Options: ");
-#ifdef NO_UCHAR
- fprintf(stderr, "NO_UCHAR, ");
-#endif
-#ifdef SIGNED_COMPARE_SLOW
- fprintf(stderr, "SIGNED_COMPARE_SLOW, ");
-#endif
-#ifdef XENIX_16
- fprintf(stderr, "XENIX_16, ");
-#endif
-#ifdef COMPATIBLE
- fprintf(stderr, "COMPATIBLE, ");
-#endif
-#ifdef DEBUG
- fprintf(stderr, "DEBUG, ");
-#endif
-#ifdef BSD4_2
- fprintf(stderr, "BSD4_2, ");
-#endif
- fprintf(stderr, "BITS = %d\n", BITS);
-}
-
-
-
-
-/* SPECSPECSPECSPECSPECSPECSPECSPECSPECSPECSPECSPECSPECSPECSPECSPECSPECSPECSPECSPECSPECSPECSPEC */
-getbyte()
-{
- if( InCnt > 0 ) {
- InCnt--;
- return( (unsigned int)*InBuff++ );
- } else {
- return( -1 );
- }
-}
-
-putbyte( c )
-char c;
-{
- *OutBuff++ = c;
-}
-
-readbytes( buf, n )
-char *buf;
-int n;
-{
- int i;
-
- if( InCnt <= 0 )
- return( -1 );
-
- if( n > InCnt )
- n = InCnt;
-
- for( i=0; i<n; i++ ) {
- buf[i] = *InBuff++;
- InCnt--;
- }
-
- return( i );
-}
-
-writebytes( buf, n )
-char *buf;
-int n;
-{
- int i;
-
- for( i=0; i<n; i++ )
- *OutBuff++ = buf[i];
-}
-
-int main()
-{
- return 0;
-}
+++ /dev/null
-#if 1
-int f(int x)
-{
- if (x < 23) x = 23;
- if (x > 42) x = 42;
- return x;
-}
-#endif
-
-
-#if 1
-static __inline int g(int x)
-{
- return x == 42;
-}
-
-void h(int x)
-{
- if (g(x)) {
- puts("1");
- } else {
- puts("2");
- }
-}
-#endif
-
-
-#if 1
-int rand(void);
-
-void i(void)
-{
- int finish = 0;
- int x;
- int y;
- int z;
-
- for (x = 0; x < 10 && !finish; x++) {
- for (y = 0; y < 10 && !finish; y++) {
- for (z = 0; z < 10 && !finish; z++) {
- if (rand())
- finish = 1;
- //a();
- }
- }
- }
-}
-#endif
-
-
-#if 1
-int rand(void);
-
-void j(void)
-{
- int finish = 0;
- int x;
- int y;
- int z;
-
- for (x = 0; !finish; x++) {
- for (y = 0; !finish; y++) {
- for (z = 0; !finish; z++) {
- if (rand()) finish = 1;
- }
- }
- }
-}
-#endif
-
-
-#if 1
-static __inline int k(int x)
-{
- if (x < 23) x = 23;
- if (x > 42) x = 42;
- return x;
-}
-
-int l(int x)
-{
- return k(x) == 23;
-}
-#endif
-
-int main() {
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-int looptest(int x) {
- while (x) {
- printf("%d\n", x);
- }
- if (x) {
- printf("%d\n", x);
- }
- return x;
-}
-
-
-int xtest(int x) {
- if (x) {
- printf("%d\n", x);
- }
- if (x) {
- printf("%d\n", x);
- }
- return x;
-}
-
-int test(int a, int b) {
- int x = a * b;
- if (a == 0)
- return x;
- else
- return x - 1;
-}
-
-static int abs(int x) {
- if (x < 0)
- return -x;
- return x;
-}
-
-int test2(int a, int b) {
- if (a > 0) {
- return abs(a);
- }
- return b;
-}
-
-int test3(int a, int b) {
- if (a != 0) {
- b = b / -a;
- }
- return b;
-}
-
-int main(void) {
- looptest(0);
- printf("xtest() = %d\n", xtest(1));
- printf("test() = %d\n", test(0, 1));
- printf("test2() = %d\n", test2(1, 3));
- printf("test3() = %d\n", test3(-3, 3));
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-int main() {
- printf("%d\n", 0x1e00000);
- return 0;
-}
+++ /dev/null
-static const int arr[] = { 1, 2, 3 };
-
-static int func1(void) {
- return arr[1];
-}
-
-static const struct X { int a, b[2]; } data[] = { {1,{2, 3}}, {4,{5, 6}} };
-
-static int func2(void) {
- return *data[1].b;
-}
-
-static const int darr[][2] = { {1,2}, {2,3} };
-
-static int func3(void) {
- return darr[1][1];
-}
-
-int main(int argc, char *argv[]) {
- return func1() + func2() + func3() != 10;
-}
+++ /dev/null
-int convs16_s32( short t) __attribute__((noinline));
-short convs32_s16( int t) __attribute__((noinline));
-
-int convu16_s32( unsigned short t) __attribute__((noinline));
-short convu32_s16( unsigned int t) __attribute__((noinline));
-
-unsigned int convs16_u32( short t) __attribute__((noinline));
-unsigned short convs32_u16( int t) __attribute__((noinline));
-
-unsigned int convu16_u32( unsigned short t) __attribute__((noinline));
-unsigned short convu32_u16( unsigned int t) __attribute__((noinline));
-
-int convs16_s32( short t)
-{
- return t;
-}
-
-short convs32_s16( int t)
-{
- return t;
-}
-
-int convu16_s32( unsigned short t)
-{
- return t;
-}
-
-short convu32_s16( unsigned int t)
-{
- return t;
-}
-
-unsigned int convs16_u32( short t)
-{
- return t;
-}
-
-unsigned short convs32_u16( int t)
-{
- return t;
-}
-
-unsigned int convu16_u32( unsigned short t)
-{
- return t;
-}
-
-unsigned short convu32_u16( unsigned int t)
-{
- return t;
-}
-
-int main()
-{
- short s = 0x8000;
- int i = 0xF0008000;
- int a;
-
- printf(" %d -> %d = %d\n", s, i, convs16_s32( s));
- printf(" %d -> %d = %d\n", i, s, convs32_s16( i));
-
- printf(" %d -> %d = %d\n", i, s, convu32_s16( i));
- printf(" %d -> %d = %d\n", i, s, convu32_s16( i));
-
- printf(" %d -> %d = %d\n", i, s, convs32_u16( i));
- printf(" %d -> %d = %d\n", i, s, convs32_u16( i));
-
- printf(" %d -> %d = %d\n", i, s, convu32_u16( i));
- printf(" %d -> %d = %d\n", i, s, convu32_u16( i));
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-double a;
-
-double test(double d) {
- float x = d;
- double d1 = x;
- float x1 = d1;
- return x1;
-}
-
-int main() {
- printf("%f\n", test(a));
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-#ifdef __GNUC__
-long long int conv_dbl_to_ll(double d) __attribute__((noinline));
-
-long long int add_dbl_to_ll(double d1, double d2) __attribute__((noinline));
-#endif
-
-long long int conv_dbl_to_ll(double d) {
- return d;
-}
-
-long long int add_dbl_to_ll(double d1, double d2) {
- long long int a = d1;
- long long int b = d2;
-
- return d1 + d2;
-}
-
-int main(int argc) {
- double d = 5.45, d1 = 1.00, d2 = 2.5;
-
- printf("double (%lf) -> int = %lld\n", d, conv_dbl_to_ll(d));
- printf("double (%lf + %lf) -> int = %lld\n", d1, d2, add_dbl_to_ll(d1, d2));
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-int bla(char a, char b, char c, char d, short e, short f, short g, int h, int i, float j) {
- return a + b + c + d + e + f + g + h + i + (int)j;
-}
-
-int convtest_func(char c, short s, int i, float f, double d) {
- char sc = c + s;
- char ic = c + i;
- char fc = c + f;
- char dc = c + d;
- short is = s + i;
- short fs = s + f;
- short ds = s + d;
- //int ti = i + s;
- int fi = i + f;
- int di = i + d;
- float df = d + f;
-
- return bla(sc, ic, fc, dc, is, fs, ds, fi, di, df);
-}
-
-int main() {
- printf("%d (expected 7576)\n", convtest_func('a', 42, 2444, 7.753f, 8.222));
- return 0;
-}
+++ /dev/null
-/*$ -fno-inline $*/
-#include <stdio.h>
-
-int cse1(int a) {
- int x = a * 3;
- int y = 3 * a;
- return x + y;
-}
-
-int cse2(int a, int b) {
- int x = a * b;
- int y = b * a;
- return x - y;
-}
-
-int main() {
- printf("cse1(3) = %d (should be 18)\n", cse1(3));
- printf("cse2(3,4) = %d (should be 0)\n", cse2(3,4));
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-char C = 1;
-short S = 2;
-int I = 4;
-long L = 4;
-long long LL = 8;
-
-float F = 4.0;
-double D = 8.0;
-long double LD = 10.0;
-
-int a, b = 3;
-
-int d = 4;
-
-float fadd(float a, float b)
-{
- return a + b;
-}
-
-float fadd_m(float a)
-{
- return a + F;
-}
-
-int iadd(int a, int b)
-{
- return a + b + (a*b) + (a / d);
-}
-
-int iadd_m(int a)
-{
- return a + I;
-}
-
-int main (int argc, char *argv[]) {
- printf("Float Add %f\n", fadd(F, 5));
- printf("Float Add+m %f\n", fadd_m(5));
- printf("Int Add %d\n", iadd(I, 5));
- printf("Int Add+m %d\n", iadd_m(5));
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-typedef struct TypeToken
-{
- int Handle;
-} tokentype;
-
-typedef struct CppObjTypeDesc
-{
- int Handle;
-} cppobjtype;
-
-
-int test(cppobjtype *CppObject, tokentype *Anchor)
-{
- CppObject->Handle = Anchor->Handle;
- return 1;
-}
-
-int main()
-{
- cppobjtype CppObject;
- tokentype Anchor;
-
- printf("%d\n", test(&CppObject, &Anchor));
-
- return 0;
-}
+++ /dev/null
-int a;
-static int b;
-struct { int a, b; } c;
-static struct { int a, b; } d;
-static int e;
-int *ptr = &e;
-
-int main(void) {
- union { int a; char arr[4]; } u;
-
- a = 1;
- b = 0x42;
- c.a = 2;
- d.a = 0x42;
- e = 3;
- u.a = 0x42;
-
- return 0;
-}
+++ /dev/null
-#!/usr/bin/perl -w
-
-use strict;
-use XML::Simple;
-use Data::Dumper;
-
-my $resfile_name = "result.xml";
-
-my $old_file = $ARGV[0]."/".$resfile_name;
-my $new_file = $ARGV[1]."/".$resfile_name;
-my $diff_file = "results_diff.xml";
-
-$| = 1; # perform flush after each write to STDOUT
-
-print "reading $old_file ... ";
-my $start = time;
-my $res_old = XMLin("$old_file", forcearray => 1);
-print "done (", time - $start," s)\n";
-
-print "reading $new_file ... ";
-$start = time;
-my $res_new = XMLin("$new_file", forcearray => 1);
-print "done (", time - $start," s)\n";
-
-open(DIFF, ">$diff_file") or die "Could not open $diff_file, reason:$!\n";
-
-print DIFF "<?xml version=\"1.0\"?>\n";
-print DIFF "<results>\n";
-print DIFF " <files>\n";
-print DIFF " <OLD>$old_file</OLD>\n";
-print DIFF " <NEW>$new_file</NEW>\n";
-print DIFF " </files>\n";
-
-if (! exists($res_old->{"environment"})) {
- print "environment missing in $old_file!\n";
-}
-elsif (! exists($res_new->{"environment"})) {
- print "environment missing in $new_file!\n";
-}
-else {
- print DIFF " <environment>\n";
- print DIFF " <OLD>\n";
-
- my %env = %{ @{ $res_old->{"environment"} }[0] };
-
- foreach (keys(%env)) {
- print DIFF " <$_>", @{ $env{"$_"} }[0], "</$_>\n";
- }
- print DIFF " </OLD>\n";
- print DIFF " <NEW>\n";
-
- %env = %{ @{ $res_new->{"environment"} }[0] };
-
- foreach (keys(%env)) {
- print DIFF " <$_>", @{ $env{"$_"} }[0], "</$_>\n";
- }
- print DIFF " </NEW>\n";
- print DIFF " </environment>\n";
-}
-
-my $section_old = $res_old->{"section"};
-my $section_new = $res_new->{"section"};
-
-foreach (keys(%{ $section_old })) {
- if (! exists($section_new->{"$_"})) {
- print "Section $_ missing in $new_file!\n";
- next;
- }
-
- print DIFF " <section name=\"$_\">\n";
-
- my $old = $section_old->{"$_"}{"result"};
- my $new = $section_new->{"$_"}{"result"};
-
- foreach my $test (keys(%{ $old })) {
- my $entry_old = $old->{"$test"};
- my $entry_new = $new->{"$test"};
- my $has_diff = 0;
-
- if (! exists($new->{"$test"})) {
- foreach my $k1 (keys(%{ $entry_old })) {
- $entry_new->{"$k1"} = [ 'missing' ];
- $has_diff = 1;
- }
- }
- else {
- foreach my $k (keys(%{ $entry_old })) {
- if (! exists($entry_new->{"$k"})) {
- $entry_new->{"$k"} = [ 'missing' ];
- $has_diff = 1;
- }
- else {
- my @val_old = @{ $entry_old->{"$k"} };
- my @val_new = @{ $entry_new->{"$k"} };
- if ($val_old[0] ne $val_new[0]) {
- $has_diff = 1;
- }
- }
- }
- }
-
- if ($has_diff == 1) {
- print DIFF " <result name=\"$test\">\n";
- print DIFF " <OLD>\n";
- emit_entry($entry_old);
- print DIFF " </OLD>\n";
- print DIFF " <NEW>\n";
- emit_entry($entry_new);
- print DIFF " </NEW>\n";
- print DIFF " </result>\n";
- }
- }
-
- print DIFF " </section>\n";
-}
-
-print DIFF "</results>\n";
-
-close(DIFF);
-
-print "processing results_diff.xml ... ";
-`xsltproc --output results_diff.html makediffhtml.xslt results_diff.xml`;
-print "results_diff.html created\n";
-
-sub emit_entry {
- my $href = shift;
-
- foreach (keys(%{ $href })) {
- my @val = @{ $href->{"$_"} };
- print DIFF " <$_>", $val[0], "</$_>\n";
- }
-}
+++ /dev/null
-#include <stdlib.h>
-#include <stdio.h>
-
-#define T_(op1, op2, va, vb, vc) a = va; b = vb; c = vc; \
- fprintf(stderr, "Test: (%d %s %d) %s (%d %s %d) -> ", a, #op1, c, #op2, b, #op1, c);\
- fprintf(stderr, "%d\n", ((a op1 c) op2 (b op1 c)));
-
-#define T(op1, op2) T_(op1, op2, rand(), rand(), rand()) T_(op1, op2, rand(), rand(), 42)
-
-#define TU_(op1, op2, va, vb) a = va; b = vb; \
- fprintf(stderr, "Test: (%s %d) %s (%s %d) -> ", #op1, a, #op2, #op1, b); \
- fprintf(stderr, "%d\n", ((op1 a) op2 (op1 b)));
-
-#define TU(op1, op2) TU_(op1, op2, rand(), rand())
-
-#define TT(op) T(&,op); T(|,op); T(^,op); T(&&,op); T(||,op); T(*,op); T(/,op); T(%,op); T(+,op); T(-,op); TU(-,op); TU(!,op);
-
-#define TS(op) T(&,op); T(|,op); T(^,op); T(&&,op); T(||,op); T(*,op); T(+,op); T(-,op); TU(-,op);
-
-int main()
-{
- int a, b, c;
- srand(1234);
-
- TT(&);
- TT(|);
- TT(^);
- TT(&&);
- TT(||);
- TT(*);
- TS(/);
- TS(%);
- TT(+);
- TT(-);
-
- return 0;
-}
+++ /dev/null
-int x = 42;
-int y = 10;
-
-int signed_div(int x, int y) {
- printf("%d (should be 4)\n", x / y);
- printf("%d (should be 2)\n", x % y);
- return (x / y) + (x % y);
-}
-
-unsigned int unsigned_div(unsigned int x, unsigned int y) {
- printf("%u (should be 4)\n", x / y);
- printf("%u (should be 2)\n", x % y);
- return (x / y) + (x % y);
-}
-
-double f_div(double x, double y) {
- printf("%f (should be 4.2)\n", x / y);
- return (x / y);
-}
-
-int main(void) {
- int x = signed_div(42, 10)
- + unsigned_div(42, 10)
- + f_div(42.0, 10.0);
- return 16-x;
-}
+++ /dev/null
-int divtest_1(int a)
-{
- return a / 2;
-}
-
-int divtest_2(int a)
-{
- return a / 8;
-}
-
-unsigned divtest_3(unsigned a)
-{
- return a / 8;
-}
-
-int modtest_1(int a)
-{
- return a % 2;
-}
-
-int modtest_2(int a)
-{
- return a % 8;
-}
-
-unsigned modtest_3(unsigned a)
-{
- return a % 8;
-}
-
-int main()
-{
- printf("+7 DIV +3 = %+d +7 MOD +3 = %+d\n", +7 / +3, +7 % +3);
- printf("-7 DIV +3 = %+d -7 MOD +3 = %+d\n", -7 / +3, -7 % +3);
- printf("+7 DIV -3 = %+d +7 MOD -3 = %+d\n", +7 / -3, +7 % -3);
- printf("-7 DIV -3 = %+d -7 MOD -3 = %+d\n", -7 / -3, -7 % -3);
-
- printf("DivTest 1 = %d\n", divtest_1(17));
- printf("DivTest 2 = %d\n", divtest_2(-17));
- printf("DivTest 3 = %u\n", divtest_3(17));
-
- printf("ModTest 1 = %d\n", modtest_1(17));
- printf("ModTest 2 = %d\n", modtest_2(-17));
- printf("ModTest 3 = %u\n", modtest_3(17));
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-int main()
-{
- char *p = "Hallo Welt\n";
- int i = 0;
-
- do {
- putchar(*p);
- ++i;
- if(i < 5)
- continue;
- putchar('.');
- i = 0;
- } while(*++p != 0);
-
- return 0;
-}
+++ /dev/null
-const char *str = "12345678901234567890";
-
-char str1[20], str2[20], str3[20];
-
-char *duff_copy(char *dst, const char *from, int count)
-{
- int n = (count+7)/8;
- char *to = dst;
-
- switch (count % 8){
- do {
- case 0: *to++ = *from++;
- case 7: *to++ = *from++;
- case 6: *to++ = *from++;
- case 5: *to++ = *from++;
- case 4: *to++ = *from++;
- case 3: *to++ = *from++;
- case 2: *to++ = *from++;
- case 1: *to++ = *from++;
- }while(--n > 0);
- }
- return dst;
-}
-
-int main(int argc, char *argv[])
-{
- printf("duff's Device 15 : %s\n", duff_copy(str1, str, 15));
- printf("duff's Device 3 : %s\n", duff_copy(str2, str, 3));
- printf("duff's Device 8 : %s\n", duff_copy(str2, str, 8));
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-static void dumpMem(void* ptr, size_t size)
-{
- size_t i;
- unsigned char* p = ptr;
- printf("\n");
- for(i = 0; i < size; ++i) {
- printf("%02x", p[i]);
- if((i % 4) == 3) {
- printf("\n");
- }
- }
- printf("\n");
-}
+++ /dev/null
-enum t {
- a, b, c, d = 5
-};
-
-int main(int argc, char *argv[])
-{
- enum t x;
-
- x = a;
- printf("a = %d\n", a);
- printf("b = %d\n", b);
- printf("c = %d\n", c);
- printf("d = %d\n", d);
-
- return 0;
-}
+++ /dev/null
-#define NOPAUSE
-/* A C version of Kahan's Floating Point Test "Paranoia"
-
- Thos Sumner, UCSF, Feb. 1985
- David Gay, BTL, Jan. 1986
-
- This is a rewrite from the Pascal version by
-
- B. A. Wichmann, 18 Jan. 1985
-
- (and does NOT exhibit good C programming style).
-
- Adjusted to use Standard C headers 19 Jan. 1992 (dmg);
- compile with -DKR_headers or insert
-#define KR_headers
- at the beginning if you have an old-style C compiler.
-
-(C) Apr 19 1983 in BASIC version by:
- Professor W. M. Kahan,
- 567 Evans Hall
- Electrical Engineering & Computer Science Dept.
- University of California
- Berkeley, California 94720
- USA
-
-converted to Pascal by:
- B. A. Wichmann
- National Physical Laboratory
- Teddington Middx
- TW11 OLW
- UK
-
-converted to C by:
-
- David M. Gay and Thos Sumner
- AT&T Bell Labs Computer Center, Rm. U-76
- 600 Mountain Avenue University of California
- Murray Hill, NJ 07974 San Francisco, CA 94143
- USA USA
-
-with simultaneous corrections to the Pascal source (reflected
-in the Pascal source available over netlib).
-[A couple of bug fixes from dgh = sun!dhough incorporated 31 July 1986.]
-
-Reports of results on various systems from all the versions
-of Paranoia are being collected by Richard Karpinski at the
-same address as Thos Sumner. This includes sample outputs,
-bug reports, and criticisms.
-
-You may copy this program freely if you acknowledge its source.
-Comments on the Pascal version to NPL, please.
-
-
-The C version catches signals from floating-point exceptions.
-If signal(SIGFPE,...) is unavailable in your environment, you may
-#define NOSIGNAL to comment out the invocations of signal.
-
-This source file is too big for some C compilers, but may be split
-into pieces. Comments containing "SPLIT" suggest convenient places
-for this splitting. At the end of these comments is an "ed script"
-(for the UNIX(tm) editor ed) that will do this splitting.
-
-By #defining Single when you compile this source, you may obtain
-a single-precision C version of Paranoia.
-
-
-The following is from the introductory commentary from Wichmann's work:
-
-The BASIC program of Kahan is written in Microsoft BASIC using many
-facilities which have no exact analogy in Pascal. The Pascal
-version below cannot therefore be exactly the same. Rather than be
-a minimal transcription of the BASIC program, the Pascal coding
-follows the conventional style of block-structured languages. Hence
-the Pascal version could be useful in producing versions in other
-structured languages.
-
-Rather than use identifiers of minimal length (which therefore have
-little mnemonic significance), the Pascal version uses meaningful
-identifiers as follows [Note: A few changes have been made for C]:
-
-
-BASIC C BASIC C BASIC C
-
- A J S StickyBit
- A1 AInverse J0 NoErrors T
- B Radix [Failure] T0 Underflow
- B1 BInverse J1 NoErrors T2 ThirtyTwo
- B2 RadixD2 [SeriousDefect] T5 OneAndHalf
- B9 BMinusU2 J2 NoErrors T7 TwentySeven
- C [Defect] T8 TwoForty
- C1 CInverse J3 NoErrors U OneUlp
- D [Flaw] U0 UnderflowThreshold
- D4 FourD K PageNo U1
- E0 L Milestone U2
- E1 M V
- E2 Exp2 N V0
- E3 N1 V8
- E5 MinSqEr O Zero V9
- E6 SqEr O1 One W
- E7 MaxSqEr O2 Two X
- E8 O3 Three X1
- E9 O4 Four X8
- F1 MinusOne O5 Five X9 Random1
- F2 Half O8 Eight Y
- F3 Third O9 Nine Y1
- F6 P Precision Y2
- F9 Q Y9 Random2
- G1 GMult Q8 Z
- G2 GDiv Q9 Z0 PseudoZero
- G3 GAddSub R Z1
- H R1 RMult Z2
- H1 HInverse R2 RDiv Z9
- I R3 RAddSub
- IO NoTrials R4 RSqrt
- I3 IEEE R9 Random9
-
- SqRWrng
-
-All the variables in BASIC are true variables and in consequence,
-the program is more difficult to follow since the "constants" must
-be determined (the glossary is very helpful). The Pascal version
-uses Real constants, but checks are added to ensure that the values
-are correctly converted by the compiler.
-
-The major textual change to the Pascal version apart from the
-identifiersis that named procedures are used, inserting parameters
-wherehelpful. New procedures are also introduced. The
-correspondence is as follows:
-
-
-BASIC Pascal
-lines
-
- 90- 140 Pause
- 170- 250 Instructions
- 380- 460 Heading
- 480- 670 Characteristics
- 690- 870 History
-2940-2950 Random
-3710-3740 NewD
-4040-4080 DoesYequalX
-4090-4110 PrintIfNPositive
-4640-4850 TestPartialUnderflow
-
-=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=*=
-
-Below is an "ed script" that splits para.c into 10 files
-of the form part[1-8].c, subs.c, and msgs.c, plus a header
-file, paranoia.h, that these files require.
-
-r paranoia.c
-$
-?SPLIT
- .d
-+d
--,$w msgs.c
--,$d
-?SPLIT
- .d
-+d
--,$w subs.c
--,$d
-?part8
-+d
-?include
- .,$w part8.c
- .,$d
--d
-?part7
-+d
-?include
- .,$w part7.c
- .,$d
--d
-?part6
-+d
-?include
- .,$w part6.c
- .,$d
--d
-?part5
-+d
-?include
- .,$w part5.c
- .,$d
--d
-?part4
-+d
-?include
- .,$w part4.c
- .,$d
--d
-?part3
-+d
-?include
- .,$w part3.c
- .,$d
--d
-?part2
-+d
-?include
- .,$w part2.c
- .,$d
-?SPLIT
- .d
-1,/^#include/-1d
-1,$w part1.c
-/Computed constants/,$d
-1,$s/^int/extern &/
-1,$s/^FLOAT/extern &/
-1,$s/^char/extern &/
-1,$s! = .*!;!
-/^Guard/,/^Round/s/^/extern /
-/^jmp_buf/s/^/extern /
-/^Sig_type/s/^/extern /
-s/$/\
-extern void sigfpe(INT);/
-w paranoia.h
-q
-
-*/
-
-#include <stdio.h>
-#ifndef NOSIGNAL
-#include <signal.h>
-#endif
-#include <setjmp.h>
-
-#if #cpu(r4640) || #cpu(r4650)
-#define Single
-#endif
-
-#ifdef Single
-#define FLOAT float
-#define FABS(x) fabsf((x))
-#define FLOOR(x) (float)floor((double)(x))
-#define LOG(x) (float)log((double)(x))
-#define POW(x,y) (float)pow((double)(x),(double)(y))
-#define SQRT(x) sqrtf((x))
-#else
-#define FLOAT double
-#define FABS(x) fabs(x)
-#define FLOOR(x) floor(x)
-#define LOG(x) log(x)
-#define POW(x,y) pow(x,y)
-#define SQRT(x) sqrt(x)
-#endif
-
-jmp_buf ovfl_buf;
-#ifdef KR_headers
-#define VOID /* void */
-#define INT /* int */
-#define FP /* FLOAT */
-#define CHARP /* char * */
-#define CHARPP /* char ** */
-extern double fabs(), floor(), log(), pow(), sqrt();
-extern void exit();
-typedef void (*Sig_type)();
-FLOAT Sign(), Random();
-extern void BadCond();
-extern void SqXMinX();
-extern void TstCond();
-extern void notify();
-extern int read();
-#else
-#define VOID void
-#define INT int
-#define FP FLOAT
-#define CHARP char *
-#define CHARPP char **
-#ifdef __STDC__
-#include <stdlib.h>
-#include <math.h>
-#else
-#ifdef __cplusplus
-extern "C" {
-#endif
-extern double fabs(double), floor(double), log(double);
-extern double pow(double,double), sqrt(double);
-extern void exit(INT);
-#ifdef __cplusplus
- }
-#endif
-#endif
-typedef void (*Sig_type)(int);
-FLOAT Sign(FLOAT), Random(void);
-extern void BadCond(int, char*);
-extern void SqXMinX(int);
-extern void TstCond(int, int, char*);
-extern void notify(char*);
-extern int read(int, char*, int);
-#endif
-#undef V9
-extern void Characteristics(VOID);
-extern void Heading(VOID);
-extern void History(VOID);
-extern void Instructions(VOID);
-extern void IsYeqX(VOID);
-extern void NewD(VOID);
-extern void Pause(VOID);
-extern void PrintIfNPositive(VOID);
-extern void SR3750(VOID);
-extern void SR3980(VOID);
-extern void TstPtUf(VOID);
-
-Sig_type sigsave;
-
-#define KEYBOARD 0
-
-FLOAT Radix, BInvrse, RadixD2, BMinusU2;
-
-/*Small floating point constants.*/
-FLOAT Zero = 0.0;
-FLOAT Half = 0.5;
-FLOAT One = 1.0;
-FLOAT Two = 2.0;
-FLOAT Three = 3.0;
-FLOAT Four = 4.0;
-FLOAT Five = 5.0;
-FLOAT Eight = 8.0;
-FLOAT Nine = 9.0;
-FLOAT TwentySeven = 27.0;
-FLOAT ThirtyTwo = 32.0;
-FLOAT TwoForty = 240.0;
-FLOAT MinusOne = -1.0;
-FLOAT OneAndHalf = 1.5;
-/*Integer constants*/
-int NoTrials = 20; /*Number of tests for commutativity. */
-#define False 0
-#define True 1
-
-/* Definitions for declared types
- Guard == (Yes, No);
- Rounding == (Chopped, Rounded, Other);
- Message == packed array [1..40] of char;
- Class == (Flaw, Defect, Serious, Failure);
- */
-#define Yes 1
-#define No 0
-#define Chopped 2
-#define Rounded 1
-#define Other 0
-#define Flaw 3
-#define Defect 2
-#define Serious 1
-#define Failure 0
-typedef int Guard, Rounding, Class;
-typedef char Message;
-
-/* Declarations of Variables */
-int Indx;
-char ch[8];
-FLOAT AInvrse, A1;
-FLOAT C, CInvrse;
-FLOAT D, FourD;
-FLOAT E0, E1, Exp2, E3, MinSqEr;
-FLOAT SqEr, MaxSqEr, E9;
-FLOAT Third;
-FLOAT F6, F9;
-FLOAT H, HInvrse;
-int I;
-FLOAT StickyBit, J;
-FLOAT MyZero;
-FLOAT Precision;
-FLOAT Q, Q9;
-FLOAT R, Random9;
-FLOAT T, Underflow, S;
-FLOAT OneUlp, UfThold, U1, U2;
-FLOAT V, V0, V9;
-FLOAT W;
-FLOAT X, X1, X2, X8, Random1;
-FLOAT Y, Y1, Y2, Random2;
-FLOAT Z, PseudoZero, Z1, Z2, Z9;
-int ErrCnt[4];
-int fpecount;
-int Milestone;
-int PageNo;
-int M, N, N1;
-Guard GMult, GDiv, GAddSub;
-Rounding RMult, RDiv, RAddSub, RSqrt;
-int Break, Done, NotMonot, Monot, Anomaly, IEEE,
- SqRWrng, UfNGrad;
-/* Computed constants. */
-/*U1 gap below 1.0, i.e, 1.0-U1 is next number below 1.0 */
-/*U2 gap above 1.0, i.e, 1.0+U2 is next number above 1.0 */
-
-/* floating point exception receiver */
- void
-sigfpe(INT x)
-{
- fpecount++;
- printf("\n* * * FLOATING-POINT ERROR %d * * *\n", x);
- fflush(stdout);
- if (sigsave) {
-#ifndef NOSIGNAL
- signal(SIGFPE, sigsave);
-#endif
- sigsave = 0;
- longjmp(ovfl_buf, 1);
- }
- exit(1);
-}
-
-
-main (VOID)
-{
- /* First two assignments use integer right-hand sides. */
- Zero = 0;
- One = 1;
- Two = One + One;
- Three = Two + One;
- Four = Three + One;
- Five = Four + One;
- Eight = Four + Four;
- Nine = Three * Three;
- TwentySeven = Nine * Three;
- ThirtyTwo = Four * Eight;
- TwoForty = Four * Five * Three * Four;
- MinusOne = -One;
- Half = One / Two;
- OneAndHalf = One + Half;
- ErrCnt[Failure] = 0;
- ErrCnt[Serious] = 0;
- ErrCnt[Defect] = 0;
- ErrCnt[Flaw] = 0;
- PageNo = 1;
- /*=============================================*/
- Milestone = 0;
- /*=============================================*/
-#ifndef NOSIGNAL
- signal(SIGFPE, sigfpe);
-#endif
- Instructions();
- Pause();
- Heading();
- Pause();
- Characteristics();
- Pause();
- History();
- Pause();
- /*=============================================*/
- Milestone = 7;
- /*=============================================*/
- printf("Program is now RUNNING tests on small integers:\n");
-
- TstCond (Failure, (Zero + Zero == Zero) && (One - One == Zero)
- && (One > Zero) && (One + One == Two),
- "0+0 != 0, 1-1 != 0, 1 <= 0, or 1+1 != 2");
- Z = - Zero;
- if (Z != (FLOAT)0.0) {
- ErrCnt[Failure] = ErrCnt[Failure] + 1;
- printf("Comparison alleges that -0.0 is Non-zero!\n");
- U1 = (FLOAT)0.001;
- Radix = 1;
- TstPtUf();
- }
- TstCond (Failure, (Three == Two + One) && (Four == Three + One)
- && (Four + Two * (- Two) == Zero)
- && (Four - Three - One == Zero),
- "3 != 2+1, 4 != 3+1, 4+2*(-2) != 0, or 4-3-1 != 0");
- TstCond (Failure, (MinusOne == (0 - One))
- && (MinusOne + One == Zero ) && (One + MinusOne == Zero)
- && (MinusOne + FABS(One) == Zero)
- && (MinusOne + MinusOne * MinusOne == Zero),
- "-1+1 != 0, (-1)+abs(1) != 0, or -1+(-1)*(-1) != 0");
- TstCond (Failure, Half + MinusOne + Half == Zero,
- "1/2 + (-1) + 1/2 != 0");
- /*=============================================*/
- /*SPLIT
- {
- extern void part2(VOID), part3(VOID), part4(VOID),
- part5(VOID), part6(VOID), part7(VOID);
- int part8(VOID);
-
- part2();
- part3();
- part4();
- part5();
- part6();
- part7();
- return part8();
- }
- }
-#include "paranoia.h"
-void part2(VOID){
-*/
- Milestone = 10;
- /*=============================================*/
- TstCond (Failure, (Nine == Three * Three)
- && (TwentySeven == Nine * Three) && (Eight == Four + Four)
- && (ThirtyTwo == Eight * Four)
- && (ThirtyTwo - TwentySeven - Four - One == Zero),
- "9 != 3*3, 27 != 9*3, 32 != 8*4, or 32-27-4-1 != 0");
- TstCond (Failure, (Five == Four + One) &&
- (TwoForty == Four * Five * Three * Four)
- && (TwoForty / Three - Four * Four * Five == Zero)
- && ( TwoForty / Four - Five * Three * Four == Zero)
- && ( TwoForty / Five - Four * Three * Four == Zero),
- "5 != 4+1, 240/3 != 80, 240/4 != 60, or 240/5 != 48");
- if (ErrCnt[Failure] == 0) {
- printf("-1, 0, 1/2, 1, 2, 3, 4, 5, 9, 27, 32 & 240 are O.K.\n");
- printf("\n");
- }
- printf("Searching for Radix and Precision.\n");
- W = One;
- do {
- W = W + W;
- Y = W + One;
- Z = Y - W;
- Y = Z - One;
- } while (MinusOne + FABS(Y) < Zero);
- /*.. now W is just big enough that |((W+1)-W)-1| >= 1 ...*/
- Precision = Zero;
- Y = One;
- do {
- Radix = W + Y;
- Y = Y + Y;
- Radix = Radix - W;
- } while ( Radix == Zero);
- if (Radix < Two) Radix = One;
- printf("Radix = %f .\n", Radix);
- if (Radix != 1) {
- W = One;
- do {
- Precision = Precision + One;
- W = W * Radix;
- Y = W + One;
- } while ((Y - W) == One);
- }
- /*... now W == Radix^Precision is barely too big to satisfy (W+1)-W == 1
- ...*/
- U1 = One / W;
- U2 = Radix * U1;
- printf("Closest relative separation found is U1 = %.7e .\n\n", U1);
- printf("Recalculating radix and precision\n ");
-
- /*save old values*/
- E0 = Radix;
- E1 = U1;
- E9 = U2;
- E3 = Precision;
-
- X = Four / Three;
- Third = X - One;
- F6 = Half - Third;
- X = F6 + F6;
- X = FABS(X - Third);
- if (X < U2) X = U2;
-
- /*... now X = (unknown no.) ulps of 1+...*/
- do {
- U2 = X;
- Y = Half * U2 + ThirtyTwo * U2 * U2;
- Y = One + Y;
- X = Y - One;
- } while ( ! ((U2 <= X) || (X <= Zero)));
-
- /*... now U2 == 1 ulp of 1 + ... */
- X = Two / Three;
- F6 = X - Half;
- Third = F6 + F6;
- X = Third - Half;
- X = FABS(X + F6);
- if (X < U1) X = U1;
-
- /*... now X == (unknown no.) ulps of 1 -... */
- do {
- U1 = X;
- Y = Half * U1 + ThirtyTwo * U1 * U1;
- Y = Half - Y;
- X = Half + Y;
- Y = Half - X;
- X = Half + Y;
- } while ( ! ((U1 <= X) || (X <= Zero)));
- /*... now U1 == 1 ulp of 1 - ... */
- if (U1 == E1) printf("confirms closest relative separation U1 .\n");
- else printf("gets better closest relative separation U1 = %.7e .\n", U1);
- W = One / U1;
- F9 = (Half - U1) + Half;
- Radix = FLOOR((FLOAT)0.01 + U2 / U1);
- if (Radix == E0) printf("Radix confirmed.\n");
- else printf("MYSTERY: recalculated Radix = %.7e .\n", Radix);
- TstCond (Defect, Radix <= Eight + Eight,
- "Radix is too big: roundoff problems");
- TstCond (Flaw, (Radix == Two) || (Radix == 10)
- || (Radix == One), "Radix is not as good as 2 or 10");
- /*=============================================*/
- Milestone = 20;
- /*=============================================*/
- TstCond (Failure, F9 - Half < Half,
- "(1-U1)-1/2 < 1/2 is FALSE, prog. fails?");
- X = F9;
- I = 1;
- Y = X - Half;
- Z = Y - Half;
- TstCond (Failure, (X != One)
- || (Z == Zero), "Comparison is fuzzy,X=1 but X-1/2-1/2 != 0");
- X = One + U2;
- I = 0;
- /*=============================================*/
- Milestone = 25;
- /*=============================================*/
- /*... BMinusU2 = nextafter(Radix, 0) */
- BMinusU2 = Radix - One;
- BMinusU2 = (BMinusU2 - U2) + One;
- /* Purify Integers */
- if (Radix != One) {
- X = - TwoForty * LOG(U1) / LOG(Radix);
- Y = FLOOR(Half + X);
- if (FABS(X - Y) * Four < One) X = Y;
- Precision = X / TwoForty;
- Y = FLOOR(Half + Precision);
- if (FABS(Precision - Y) * TwoForty < Half) Precision = Y;
- }
- if ((Precision != FLOOR(Precision)) || (Radix == One)) {
- printf("Precision cannot be characterized by an Integer number\n");
- printf("of significant digits but, by itself, this is a minor flaw.\n");
- }
- if (Radix == One)
- printf("logarithmic encoding has precision characterized solely by U1.\n");
- else printf("The number of significant digits of the Radix is %f .\n",
- Precision);
- TstCond (Serious, U2 * Nine * Nine * TwoForty < One,
- "Precision worse than 5 decimal figures ");
- /*=============================================*/
- Milestone = 30;
- /*=============================================*/
- /* Test for extra-precise subepressions */
- X = FABS(((Four / Three - One) - One / Four) * Three - One / Four);
- do {
- Z2 = X;
- X = (One + (Half * Z2 + ThirtyTwo * Z2 * Z2)) - One;
- } while ( ! ((Z2 <= X) || (X <= Zero)));
- X = Y = Z = FABS((Three / Four - Two / Three) * Three - One / Four);
- do {
- Z1 = Z;
- Z = (One / Two - ((One / Two - (Half * Z1 + ThirtyTwo * Z1 * Z1))
- + One / Two)) + One / Two;
- } while ( ! ((Z1 <= Z) || (Z <= Zero)));
- do {
- do {
- Y1 = Y;
- Y = (Half - ((Half - (Half * Y1 + ThirtyTwo * Y1 * Y1)) + Half
- )) + Half;
- } while ( ! ((Y1 <= Y) || (Y <= Zero)));
- X1 = X;
- X = ((Half * X1 + ThirtyTwo * X1 * X1) - F9) + F9;
- } while ( ! ((X1 <= X) || (X <= Zero)));
- if ((X1 != Y1) || (X1 != Z1)) {
- BadCond(Serious, "Disagreements among the values X1, Y1, Z1,\n");
- printf("respectively %.7e, %.7e, %.7e,\n", X1, Y1, Z1);
- printf("are symptoms of inconsistencies introduced\n");
- printf("by extra-precise evaluation of arithmetic subexpressions.\n");
- notify("Possibly some part of this");
- if ((X1 == U1) || (Y1 == U1) || (Z1 == U1)) printf(
- "That feature is not tested further by this program.\n") ;
- }
- else {
- if ((Z1 != U1) || (Z2 != U2)) {
- if ((Z1 >= U1) || (Z2 >= U2)) {
- BadCond(Failure, "");
- notify("Precision");
- printf("\tU1 = %.7e, Z1 - U1 = %.7e\n",U1,Z1-U1);
- printf("\tU2 = %.7e, Z2 - U2 = %.7e\n",U2,Z2-U2);
- }
- else {
- if ((Z1 <= Zero) || (Z2 <= Zero)) {
- printf("Because of unusual Radix = %f", Radix);
- printf(", or exact rational arithmetic a result\n");
- printf("Z1 = %.7e, or Z2 = %.7e ", Z1, Z2);
- notify("of an\nextra-precision");
- }
- if (Z1 != Z2 || Z1 > Zero) {
- X = Z1 / U1;
- Y = Z2 / U2;
- if (Y > X) X = Y;
- Q = - LOG(X);
- printf("Some subexpressions appear to be calculated extra\n");
- printf("precisely with about %g extra B-digits, i.e.\n",
- (Q / LOG(Radix)));
- printf("roughly %g extra significant decimals.\n",
- Q / LOG(10.));
- }
- printf("That feature is not tested further by this program.\n");
- }
- }
- }
- Pause();
- /*=============================================*/
- /*SPLIT
- }
-#include "paranoia.h"
-void part3(VOID){
-*/
- Milestone = 35;
- /*=============================================*/
- if (Radix >= Two) {
- X = W / (Radix * Radix);
- Y = X + One;
- Z = Y - X;
- T = Z + U2;
- X = T - Z;
- TstCond (Failure, X == U2,
- "Subtraction is not normalized X=Y,X+Z != Y+Z!");
- if (X == U2) printf(
- "Subtraction appears to be normalized, as it should be.");
- }
- printf("\nChecking for guard digit in *, /, and -.\n");
- Y = F9 * One;
- Z = One * F9;
- X = F9 - Half;
- Y = (Y - Half) - X;
- Z = (Z - Half) - X;
- X = One + U2;
- T = X * Radix;
- R = Radix * X;
- X = T - Radix;
- X = X - Radix * U2;
- T = R - Radix;
- T = T - Radix * U2;
- X = X * (Radix - One);
- T = T * (Radix - One);
- if ((X == Zero) && (Y == Zero) && (Z == Zero) && (T == Zero)) GMult = Yes;
- else {
- GMult = No;
- TstCond (Serious, False,
- "* lacks a Guard Digit, so 1*X != X");
- }
- Z = Radix * U2;
- X = One + Z;
- Y = FABS((X + Z) - X * X) - U2;
- X = One - U2;
- Z = FABS((X - U2) - X * X) - U1;
- TstCond (Failure, (Y <= Zero)
- && (Z <= Zero), "* gets too many final digits wrong.\n");
- Y = One - U2;
- X = One + U2;
- Z = One / Y;
- Y = Z - X;
- X = One / Three;
- Z = Three / Nine;
- X = X - Z;
- T = Nine / TwentySeven;
- Z = Z - T;
- TstCond(Defect, X == Zero && Y == Zero && Z == Zero,
- "Division lacks a Guard Digit, so error can exceed 1 ulp\n\
-or 1/3 and 3/9 and 9/27 may disagree");
- Y = F9 / One;
- X = F9 - Half;
- Y = (Y - Half) - X;
- X = One + U2;
- T = X / One;
- X = T - X;
- if ((X == Zero) && (Y == Zero) && (Z == Zero)) GDiv = Yes;
- else {
- GDiv = No;
- TstCond (Serious, False,
- "Division lacks a Guard Digit, so X/1 != X");
- }
- X = One / (One + U2);
- Y = X - Half - Half;
- TstCond (Serious, Y < Zero,
- "Computed value of 1/1.000..1 >= 1");
- X = One - U2;
- Y = One + Radix * U2;
- Z = X * Radix;
- T = Y * Radix;
- R = Z / Radix;
- StickyBit = T / Radix;
- X = R - X;
- Y = StickyBit - Y;
- TstCond (Failure, X == Zero && Y == Zero,
- "* and/or / gets too many last digits wrong");
- Y = One - U1;
- X = One - F9;
- Y = One - Y;
- T = Radix - U2;
- Z = Radix - BMinusU2;
- T = Radix - T;
- if ((X == U1) && (Y == U1) && (Z == U2) && (T == U2)) GAddSub = Yes;
- else {
- GAddSub = No;
- TstCond (Serious, False,
- "- lacks Guard Digit, so cancellation is obscured");
- }
- if (F9 != One && F9 - One >= Zero) {
- BadCond(Serious, "comparison alleges (1-U1) < 1 although\n");
- printf(" subtraction yields (1-U1) - 1 = 0 , thereby vitiating\n");
- printf(" such precautions against division by zero as\n");
- printf(" ... if (X == 1.0) {.....} else {.../(X-1.0)...}\n");
- }
- if (GMult == Yes && GDiv == Yes && GAddSub == Yes) printf(
- " *, /, and - appear to have guard digits, as they should.\n");
- /*=============================================*/
- Milestone = 40;
- /*=============================================*/
- Pause();
- printf("Checking rounding on multiply, divide and add/subtract.\n");
- RMult = Other;
- RDiv = Other;
- RAddSub = Other;
- RadixD2 = Radix / Two;
- A1 = Two;
- Done = False;
- do {
- AInvrse = Radix;
- do {
- X = AInvrse;
- AInvrse = AInvrse / A1;
- } while ( ! (FLOOR(AInvrse) != AInvrse));
- Done = (X == One) || (A1 > Three);
- if (! Done) A1 = Nine + One;
- } while ( ! (Done));
- if (X == One) A1 = Radix;
- AInvrse = One / A1;
- X = A1;
- Y = AInvrse;
- Done = False;
- do {
- Z = X * Y - Half;
- TstCond (Failure, Z == Half,
- "X * (1/X) differs from 1");
- Done = X == Radix;
- X = Radix;
- Y = One / X;
- } while ( ! (Done));
- Y2 = One + U2;
- Y1 = One - U2;
- X = OneAndHalf - U2;
- Y = OneAndHalf + U2;
- Z = (X - U2) * Y2;
- T = Y * Y1;
- Z = Z - X;
- T = T - X;
- X = X * Y2;
- Y = (Y + U2) * Y1;
- X = X - OneAndHalf;
- Y = Y - OneAndHalf;
- if ((X == Zero) && (Y == Zero) && (Z == Zero) && (T <= Zero)) {
- X = (OneAndHalf + U2) * Y2;
- Y = OneAndHalf - U2 - U2;
- Z = OneAndHalf + U2 + U2;
- T = (OneAndHalf - U2) * Y1;
- X = X - (Z + U2);
- StickyBit = Y * Y1;
- S = Z * Y2;
- T = T - Y;
- Y = (U2 - Y) + StickyBit;
- Z = S - (Z + U2 + U2);
- StickyBit = (Y2 + U2) * Y1;
- Y1 = Y2 * Y1;
- StickyBit = StickyBit - Y2;
- Y1 = Y1 - Half;
- if ((X == Zero) && (Y == Zero) && (Z == Zero) && (T == Zero)
- && ( StickyBit == Zero) && (Y1 == Half)) {
- RMult = Rounded;
- printf("Multiplication appears to round correctly.\n");
- }
- else if ((X + U2 == Zero) && (Y < Zero) && (Z + U2 == Zero)
- && (T < Zero) && (StickyBit + U2 == Zero)
- && (Y1 < Half)) {
- RMult = Chopped;
- printf("Multiplication appears to chop.\n");
- }
- else printf("* is neither chopped nor correctly rounded.\n");
- if ((RMult == Rounded) && (GMult == No)) notify("Multiplication");
- }
- else printf("* is neither chopped nor correctly rounded.\n");
- /*=============================================*/
- Milestone = 45;
- /*=============================================*/
- Y2 = One + U2;
- Y1 = One - U2;
- Z = OneAndHalf + U2 + U2;
- X = Z / Y2;
- T = OneAndHalf - U2 - U2;
- Y = (T - U2) / Y1;
- Z = (Z + U2) / Y2;
- X = X - OneAndHalf;
- Y = Y - T;
- T = T / Y1;
- Z = Z - (OneAndHalf + U2);
- T = (U2 - OneAndHalf) + T;
- if (! ((X > Zero) || (Y > Zero) || (Z > Zero) || (T > Zero))) {
- X = OneAndHalf / Y2;
- Y = OneAndHalf - U2;
- Z = OneAndHalf + U2;
- X = X - Y;
- T = OneAndHalf / Y1;
- Y = Y / Y1;
- T = T - (Z + U2);
- Y = Y - Z;
- Z = Z / Y2;
- Y1 = (Y2 + U2) / Y2;
- Z = Z - OneAndHalf;
- Y2 = Y1 - Y2;
- Y1 = (F9 - U1) / F9;
- if ((X == Zero) && (Y == Zero) && (Z == Zero) && (T == Zero)
- && (Y2 == Zero) && (Y2 == Zero)
- && (Y1 - Half == F9 - Half )) {
- RDiv = Rounded;
- printf("Division appears to round correctly.\n");
- if (GDiv == No) notify("Division");
- }
- else if ((X < Zero) && (Y < Zero) && (Z < Zero) && (T < Zero)
- && (Y2 < Zero) && (Y1 - Half < F9 - Half)) {
- RDiv = Chopped;
- printf("Division appears to chop.\n");
- }
- }
- if (RDiv == Other) printf("/ is neither chopped nor correctly rounded.\n");
- BInvrse = One / Radix;
- TstCond (Failure, (BInvrse * Radix - Half == Half),
- "Radix * ( 1 / Radix ) differs from 1");
- /*=============================================*/
- /*SPLIT
- }
-#include "paranoia.h"
-void part4(VOID){
-*/
- Milestone = 50;
- /*=============================================*/
- TstCond (Failure, ((F9 + U1) - Half == Half)
- && ((BMinusU2 + U2 ) - One == Radix - One),
- "Incomplete carry-propagation in Addition");
- X = One - U1 * U1;
- Y = One + U2 * (One - U2);
- Z = F9 - Half;
- X = (X - Half) - Z;
- Y = Y - One;
- if ((X == Zero) && (Y == Zero)) {
- RAddSub = Chopped;
- printf("Add/Subtract appears to be chopped.\n");
- }
- if (GAddSub == Yes) {
- X = (Half + U2) * U2;
- Y = (Half - U2) * U2;
- X = One + X;
- Y = One + Y;
- X = (One + U2) - X;
- Y = One - Y;
- if ((X == Zero) && (Y == Zero)) {
- X = (Half + U2) * U1;
- Y = (Half - U2) * U1;
- X = One - X;
- Y = One - Y;
- X = F9 - X;
- Y = One - Y;
- if ((X == Zero) && (Y == Zero)) {
- RAddSub = Rounded;
- printf("Addition/Subtraction appears to round correctly.\n");
- if (GAddSub == No) notify("Add/Subtract");
- }
- else printf("Addition/Subtraction neither rounds nor chops.\n");
- }
- else printf("Addition/Subtraction neither rounds nor chops.\n");
- }
- else printf("Addition/Subtraction neither rounds nor chops.\n");
- S = One;
- X = One + Half * (One + Half);
- Y = (One + U2) * Half;
- Z = X - Y;
- T = Y - X;
- StickyBit = Z + T;
- if (StickyBit != Zero) {
- S = Zero;
- BadCond(Flaw, "(X - Y) + (Y - X) is non zero!\n");
- }
- StickyBit = Zero;
- if ((GMult == Yes) && (GDiv == Yes) && (GAddSub == Yes)
- && (RMult == Rounded) && (RDiv == Rounded)
- && (RAddSub == Rounded) && (FLOOR(RadixD2) == RadixD2)) {
- printf("Checking for sticky bit.\n");
- X = (Half + U1) * U2;
- Y = Half * U2;
- Z = One + Y;
- T = One + X;
- if ((Z - One <= Zero) && (T - One >= U2)) {
- Z = T + Y;
- Y = Z - X;
- if ((Z - T >= U2) && (Y - T == Zero)) {
- X = (Half + U1) * U1;
- Y = Half * U1;
- Z = One - Y;
- T = One - X;
- if ((Z - One == Zero) && (T - F9 == Zero)) {
- Z = (Half - U1) * U1;
- T = F9 - Z;
- Q = F9 - Y;
- if ((T - F9 == Zero) && (F9 - U1 - Q == Zero)) {
- Z = (One + U2) * OneAndHalf;
- T = (OneAndHalf + U2) - Z + U2;
- X = One + Half / Radix;
- Y = One + Radix * U2;
- Z = X * Y;
- if (T == Zero && X + Radix * U2 - Z == Zero) {
- if (Radix != Two) {
- X = Two + U2;
- Y = X / Two;
- if ((Y - One == Zero)) StickyBit = S;
- }
- else StickyBit = S;
- }
- }
- }
- }
- }
- }
- if (StickyBit == One) printf("Sticky bit apparently used correctly.\n");
- else printf("Sticky bit used incorrectly or not at all.\n");
- TstCond (Flaw, !(GMult == No || GDiv == No || GAddSub == No ||
- RMult == Other || RDiv == Other || RAddSub == Other),
- "lack(s) of guard digits or failure(s) to correctly round or chop\n\
-(noted above) count as one flaw in the final tally below");
- /*=============================================*/
- Milestone = 60;
- /*=============================================*/
- printf("\n");
- printf("Does Multiplication commute? ");
- printf("Testing on %d random pairs.\n", NoTrials);
- Random9 = SQRT(3.0);
- Random1 = Third;
- I = 1;
- do {
- X = Random();
- Y = Random();
- Z9 = Y * X;
- Z = X * Y;
- Z9 = Z - Z9;
- I = I + 1;
- } while ( ! ((I > NoTrials) || (Z9 != Zero)));
- if (I == NoTrials) {
- Random1 = One + Half / Three;
- Random2 = (U2 + U1) + One;
- Z = Random1 * Random2;
- Y = Random2 * Random1;
- Z9 = (One + Half / Three) * ((U2 + U1) + One) - (One + Half /
- Three) * ((U2 + U1) + One);
- }
- if (! ((I == NoTrials) || (Z9 == Zero)))
- BadCond(Defect, "X * Y == Y * X trial fails.\n");
- else printf(" No failures found in %d integer pairs.\n", NoTrials);
- /*=============================================*/
- Milestone = 70;
- /*=============================================*/
- printf("\nRunning test of square root(x).\n");
- TstCond (Failure, (Zero == SQRT(Zero))
- && (- Zero == SQRT(- Zero))
- && (One == SQRT(One)), "Square root of 0.0, -0.0 or 1.0 wrong");
- MinSqEr = Zero;
- MaxSqEr = Zero;
- J = Zero;
- X = Radix;
- OneUlp = U2;
- SqXMinX (Serious);
- X = BInvrse;
- OneUlp = BInvrse * U1;
- SqXMinX (Serious);
- X = U1;
- OneUlp = U1 * U1;
- SqXMinX (Serious);
- if (J != Zero) Pause();
- printf("Testing if sqrt(X * X) == X for %d Integers X.\n", NoTrials);
- J = Zero;
- X = Two;
- Y = Radix;
- if ((Radix != One)) do {
- X = Y;
- Y = Radix * Y;
- } while ( ! ((Y - X >= NoTrials)));
- OneUlp = X * U2;
- I = 1;
- while (I <= NoTrials) {
- X = X + One;
- SqXMinX (Defect);
- if (J > Zero) break;
- I = I + 1;
- }
- printf("Test for sqrt monotonicity.\n");
- I = - 1;
- X = BMinusU2;
- Y = Radix;
- Z = Radix + Radix * U2;
- NotMonot = False;
- Monot = False;
- while ( ! (NotMonot || Monot)) {
- I = I + 1;
- X = SQRT(X);
- Q = SQRT(Y);
- Z = SQRT(Z);
- if ((X > Q) || (Q > Z)) NotMonot = True;
- else {
- Q = FLOOR(Q + Half);
- if ((I > 0) || (Radix == Q * Q)) Monot = True;
- else if (I > 0) {
- if (I > 1) Monot = True;
- else {
- Y = Y * BInvrse;
- X = Y - U1;
- Z = Y + U1;
- }
- }
- else {
- Y = Q;
- X = Y - U2;
- Z = Y + U2;
- }
- }
- }
- if (Monot) printf("sqrt has passed a test for Monotonicity.\n");
- else {
- BadCond(Defect, "");
- printf("sqrt(X) is non-monotonic for X near %.7e .\n", Y);
- }
- /*=============================================*/
- /*SPLIT
- }
-#include "paranoia.h"
-void part5(VOID){
-*/
- Milestone = 80;
- /*=============================================*/
- MinSqEr = MinSqEr + Half;
- MaxSqEr = MaxSqEr - Half;
- Y = (SQRT(One + U2) - One) / U2;
- SqEr = (Y - One) + U2 / Eight;
- if (SqEr > MaxSqEr) MaxSqEr = SqEr;
- SqEr = Y + U2 / Eight;
- if (SqEr < MinSqEr) MinSqEr = SqEr;
- Y = ((SQRT(F9) - U2) - (One - U2)) / U1;
- SqEr = Y + U1 / Eight;
- if (SqEr > MaxSqEr) MaxSqEr = SqEr;
- SqEr = (Y + One) + U1 / Eight;
- if (SqEr < MinSqEr) MinSqEr = SqEr;
- OneUlp = U2;
- X = OneUlp;
- for( Indx = 1; Indx <= 3; ++Indx) {
- Y = SQRT((X + U1 + X) + F9);
- Y = ((Y - U2) - ((One - U2) + X)) / OneUlp;
- Z = ((U1 - X) + F9) * Half * X * X / OneUlp;
- SqEr = (Y + Half) + Z;
- if (SqEr < MinSqEr) MinSqEr = SqEr;
- SqEr = (Y - Half) + Z;
- if (SqEr > MaxSqEr) MaxSqEr = SqEr;
- if (((Indx == 1) || (Indx == 3)))
- X = OneUlp * Sign (X) * FLOOR(Eight / (Nine * SQRT(OneUlp)));
- else {
- OneUlp = U1;
- X = - OneUlp;
- }
- }
- /*=============================================*/
- Milestone = 85;
- /*=============================================*/
- SqRWrng = False;
- Anomaly = False;
- RSqrt = Other; /* ~dgh */
- if (Radix != One) {
- printf("Testing whether sqrt is rounded or chopped.\n");
- D = FLOOR(Half + POW(Radix, One + Precision - FLOOR(Precision)));
- /* ... == Radix^(1 + fract) if (Precision == Integer + fract. */
- X = D / Radix;
- Y = D / A1;
- if ((X != FLOOR(X)) || (Y != FLOOR(Y))) {
- Anomaly = True;
- }
- else {
- X = Zero;
- Z2 = X;
- Y = One;
- Y2 = Y;
- Z1 = Radix - One;
- FourD = Four * D;
- do {
- if (Y2 > Z2) {
- Q = Radix;
- Y1 = Y;
- do {
- X1 = FABS(Q + FLOOR(Half - Q / Y1) * Y1);
- Q = Y1;
- Y1 = X1;
- } while ( ! (X1 <= Zero));
- if (Q <= One) {
- Z2 = Y2;
- Z = Y;
- }
- }
- Y = Y + Two;
- X = X + Eight;
- Y2 = Y2 + X;
- if (Y2 >= FourD) Y2 = Y2 - FourD;
- } while ( ! (Y >= D));
- X8 = FourD - Z2;
- Q = (X8 + Z * Z) / FourD;
- X8 = X8 / Eight;
- if (Q != FLOOR(Q)) Anomaly = True;
- else {
- Break = False;
- do {
- X = Z1 * Z;
- X = X - FLOOR(X / Radix) * Radix;
- if (X == One)
- Break = True;
- else
- Z1 = Z1 - One;
- } while ( ! (Break || (Z1 <= Zero)));
- if ((Z1 <= Zero) && (! Break)) Anomaly = True;
- else {
- if (Z1 > RadixD2) Z1 = Z1 - Radix;
- do {
- NewD();
- } while ( ! (U2 * D >= F9));
- if (D * Radix - D != W - D) Anomaly = True;
- else {
- Z2 = D;
- I = 0;
- Y = D + (One + Z) * Half;
- X = D + Z + Q;
- SR3750();
- Y = D + (One - Z) * Half + D;
- X = D - Z + D;
- X = X + Q + X;
- SR3750();
- NewD();
- if (D - Z2 != W - Z2) Anomaly = True;
- else {
- Y = (D - Z2) + (Z2 + (One - Z) * Half);
- X = (D - Z2) + (Z2 - Z + Q);
- SR3750();
- Y = (One + Z) * Half;
- X = Q;
- SR3750();
- if (I == 0) Anomaly = True;
- }
- }
- }
- }
- }
- if ((I == 0) || Anomaly) {
- BadCond(Failure, "Anomalous arithmetic with Integer < ");
- printf("Radix^Precision = %.7e\n", W);
- printf(" fails test whether sqrt rounds or chops.\n");
- SqRWrng = True;
- }
- }
- if (! Anomaly) {
- if (! ((MinSqEr < Zero) || (MaxSqEr > Zero))) {
- RSqrt = Rounded;
- printf("Square root appears to be correctly rounded.\n");
- }
- else {
- if ((MaxSqEr + U2 > U2 - Half) || (MinSqEr > Half)
- || (MinSqEr + Radix < Half)) SqRWrng = True;
- else {
- RSqrt = Chopped;
- printf("Square root appears to be chopped.\n");
- }
- }
- }
- if (SqRWrng) {
- printf("Square root is neither chopped nor correctly rounded.\n");
- printf("Observed errors run from %.7e ", MinSqEr - Half);
- printf("to %.7e ulps.\n", Half + MaxSqEr);
- TstCond (Serious, MaxSqEr - MinSqEr < Radix * Radix,
- "sqrt gets too many last digits wrong");
- }
- /*=============================================*/
- Milestone = 90;
- /*=============================================*/
- Pause();
- printf("Testing powers Z^i for small Integers Z and i.\n");
- N = 0;
- /* ... test powers of zero. */
- I = 0;
- Z = -Zero;
- M = 3;
- Break = False;
- do {
- X = One;
- SR3980();
- if (I <= 10) {
- I = 1023;
- SR3980();
- }
- if (Z == MinusOne) Break = True;
- else {
- Z = MinusOne;
- /* .. if(-1)^N is invalid, replace MinusOne by One. */
- I = - 4;
- }
- } while ( ! Break);
- PrintIfNPositive();
- N1 = N;
- N = 0;
- Z = A1;
- M = (int)FLOOR(Two * LOG(W) / LOG(A1));
- Break = False;
- do {
- X = Z;
- I = 1;
- SR3980();
- if (Z == AInvrse) Break = True;
- else Z = AInvrse;
- } while ( ! (Break));
- /*=============================================*/
- Milestone = 100;
- /*=============================================*/
- /* Powers of Radix have been tested, */
- /* next try a few primes */
- M = NoTrials;
- Z = Three;
- do {
- X = Z;
- I = 1;
- SR3980();
- do {
- Z = Z + Two;
- } while ( Three * FLOOR(Z / Three) == Z );
- } while ( Z < Eight * Three );
- if (N > 0) {
- printf("Errors like this may invalidate financial calculations\n");
- printf("\tinvolving interest rates.\n");
- }
- PrintIfNPositive();
- N += N1;
- if (N == 0) printf("... no discrepancies found.\n");
- if (N > 0) Pause();
- else printf("\n");
- /*=============================================*/
- /*SPLIT
- }
-#include "paranoia.h"
-void part6(VOID){
-*/
- Milestone = 110;
- /*=============================================*/
- printf("Seeking Underflow thresholds UfThold and E0.\n");
- D = U1;
- if (Precision != FLOOR(Precision)) {
- D = BInvrse;
- X = Precision;
- do {
- D = D * BInvrse;
- X = X - One;
- } while ( X > Zero);
- }
- Y = One;
- Z = D;
- printf("Y: %20.20f Z: %20.20f\n", Y, Z);
- /* ... D is power of 1/Radix < 1. */
- do {
- C = Y;
- Y = Z;
- Z = Y * Y;
- } while ((Y > Z) && (Z + Z > Z));
- Y = C;
- Z = Y * D;
- do {
- C = Y;
- Y = Z;
- Z = Y * D;
- } while ((Y > Z) && (Z + Z > Z));
- if (Radix < Two) HInvrse = Two;
- else HInvrse = Radix;
- H = One / HInvrse;
- /* ... 1/HInvrse == H == Min(1/Radix, 1/2) */
- CInvrse = One / C;
- E0 = C;
- Z = E0 * H;
- /* ...1/Radix^(BIG Integer) << 1 << CInvrse == 1/C */
- do {
- Y = E0;
- E0 = Z;
- Z = E0 * H;
- } while ((E0 > Z) && (Z + Z > Z));
- UfThold = E0;
- E1 = Zero;
- Q = Zero;
- E9 = U2;
- S = One + E9;
- D = C * S;
- if (D <= C) {
- E9 = Radix * U2;
- S = One + E9;
- D = C * S;
- if (D <= C) {
- BadCond(Failure, "multiplication gets too many last digits wrong.\n");
- Underflow = E0;
- Y1 = Zero;
- PseudoZero = Z;
- Pause();
- }
- }
- else {
- Underflow = D;
- PseudoZero = Underflow * H;
- UfThold = Zero;
- do {
- Y1 = Underflow;
- Underflow = PseudoZero;
- if (E1 + E1 <= E1) {
- Y2 = Underflow * HInvrse;
- E1 = FABS(Y1 - Y2);
- Q = Y1;
- if ((UfThold == Zero) && (Y1 != Y2)) UfThold = Y1;
- }
- PseudoZero = PseudoZero * H;
- } while ((Underflow > PseudoZero)
- && (PseudoZero + PseudoZero > PseudoZero));
- }
- /* Comment line 4530 .. 4560 */
- if (PseudoZero != Zero) {
- printf("\n");
- Z = PseudoZero;
- /* ... Test PseudoZero for "phoney- zero" violates */
- /* ... PseudoZero < Underflow or PseudoZero < PseudoZero + PseudoZero
- ... */
- if (PseudoZero <= Zero) {
- BadCond(Failure, "Positive expressions can underflow to an\n");
- printf("allegedly negative value\n");
- printf("PseudoZero that prints out as: %g .\n", PseudoZero);
- X = - PseudoZero;
- if (X <= Zero) {
- printf("But -PseudoZero, which should be\n");
- printf("positive, isn't; it prints out as %g .\n", X);
- }
- }
- else {
- BadCond(Flaw, "Underflow can stick at an allegedly positive\n");
- printf("value PseudoZero that prints out as %g .\n", PseudoZero);
- }
- TstPtUf();
- }
- /*=============================================*/
- Milestone = 120;
- /*=============================================*/
- if (CInvrse * Y > CInvrse * Y1) {
- S = H * S;
- E0 = Underflow;
- }
- if (! ((E1 == Zero) || (E1 == E0))) {
- BadCond(Defect, "");
- if (E1 < E0) {
- printf("Products underflow at a higher");
- printf(" threshold than differences.\n");
- if (PseudoZero == Zero)
- E0 = E1;
- }
- else {
- printf("Difference underflows at a higher");
- printf(" threshold than products.\n");
- }
- }
- printf("Smallest strictly positive number found is E0 = %g .\n", E0);
- Z = E0;
- TstPtUf();
- Underflow = E0;
- if (N == 1) Underflow = Y;
- I = 4;
- if (E1 == Zero) I = 3;
- if (UfThold == Zero) I = I - 2;
- UfNGrad = True;
- switch (I) {
- case 1:
- UfThold = Underflow;
- if ((CInvrse * Q) != ((CInvrse * Y) * S)) {
- UfThold = Y;
- BadCond(Failure, "Either accuracy deteriorates as numbers\n");
- printf("approach a threshold = %.17e\n", UfThold);;
- printf(" coming down from %.17e\n", C);
- printf(" or else multiplication gets too many last digits wrong.\n");
- }
- Pause();
- break;
-
- case 2:
- BadCond(Failure, "Underflow confuses Comparison, which alleges that\n");
- printf("Q == Y while denying that |Q - Y| == 0; these values\n");
- printf("print out as Q = %.17e, Y = %.17e .\n", Q, Y2);
- printf ("|Q - Y| = %.17e .\n" , FABS(Q - Y2));
- UfThold = Q;
- break;
-
- case 3:
- X = X;
- break;
-
- case 4:
- if ((Q == UfThold) && (E1 == E0)
- && (FABS( UfThold - E1 / E9) <= E1)) {
- UfNGrad = False;
- printf("Underflow is gradual; it incurs Absolute Error =\n");
- printf("(roundoff in UfThold) < E0.\n");
- Y = E0 * CInvrse;
- Y = Y * (OneAndHalf + U2);
- X = CInvrse * (One + U2);
- Y = Y / X;
- IEEE = (Y == E0);
- }
- }
- if (UfNGrad) {
- printf("\n");
- sigsave = sigfpe;
- if (setjmp(ovfl_buf)) {
- printf("Underflow / UfThold failed!\n");
- R = H + H;
- }
- else R = SQRT(Underflow / UfThold);
- sigsave = 0;
- if (R <= H) {
- Z = R * UfThold;
- X = Z * (One + R * H * (One + H));
- }
- else {
- Z = UfThold;
- X = Z * (One + H * H * (One + H));
- }
- if (! ((X == Z) || (X - Z != Zero))) {
- BadCond(Flaw, "");
- printf("X = %.17e\n\tis not equal to Z = %.17e .\n", X, Z);
- Z9 = X - Z;
- printf("yet X - Z yields %.17e .\n", Z9);
- printf(" Should this NOT signal Underflow, ");
- printf("this is a SERIOUS DEFECT\nthat causes ");
- printf("confusion when innocent statements like\n");;
- printf(" if (X == Z) ... else");
- printf(" ... (f(X) - f(Z)) / (X - Z) ...\n");
- printf("encounter Division by Zero although actually\n");
- sigsave = sigfpe;
- if (setjmp(ovfl_buf)) printf("X / Z fails!\n");
- else printf("X / Z = 1 + %g .\n", (X / Z - Half) - Half);
- sigsave = 0;
- }
- }
- printf("The Underflow threshold is %.17e, %s\n", UfThold,
- " below which");
- printf("calculation may suffer larger Relative error than ");
- printf("merely roundoff.\n");
- Y2 = U1 * U1;
- Y = Y2 * Y2;
- Y2 = Y * U1;
- if (Y2 <= UfThold) {
- if (Y > E0) {
- BadCond(Defect, "");
- I = 5;
- }
- else {
- BadCond(Serious, "");
- I = 4;
- }
- printf("Range is too narrow; U1^%d Underflows.\n", I);
- }
- /*=============================================*/
- /*SPLIT
- }
-#include "paranoia.h"
-void part7(VOID){
-*/
- Milestone = 130;
- /*=============================================*/
- Y = - FLOOR(Half - TwoForty * LOG(UfThold) / LOG(HInvrse)) / TwoForty;
- Y2 = Y + Y;
- printf("Since underflow occurs below the threshold\n");
- printf("UfThold = (%.17e) ^ (%.17e)\nonly underflow ", HInvrse, Y);
- printf("should afflict the expression\n\t(%.17e) ^ (%.17e);\n",
- HInvrse, Y2);
- printf("actually calculating yields:");
- if (setjmp(ovfl_buf)) {
- sigsave = 0;
- BadCond(Serious, "trap on underflow.\n");
- }
- else {
- sigsave = sigfpe;
- V9 = POW(HInvrse, Y2);
- sigsave = 0;
- printf(" %.17e .\n", V9);
- if (! ((V9 >= Zero) && (V9 <= (Radix + Radix + E9) * UfThold))) {
- BadCond(Serious, "this is not between 0 and underflow\n");
- printf(" threshold = %.17e .\n", UfThold);
- }
- else if (! (V9 > UfThold * (One + E9)))
- printf("This computed value is O.K.\n");
- else {
- BadCond(Defect, "this is not between 0 and underflow\n");
- printf(" threshold = %.17e .\n", UfThold);
- }
- }
- /*=============================================*/
- Milestone = 140;
- /*=============================================*/
- printf("\n");
- /* ...calculate Exp2 == exp(2) == 7.389056099... */
- X = Zero;
- I = 2;
- Y = Two * Three;
- Q = Zero;
- N = 0;
- do {
- Z = X;
- I = I + 1;
- Y = Y / (I + I);
- R = Y + Q;
- X = Z + R;
- Q = (Z - X) + R;
- } while(X > Z);
- Z = (OneAndHalf + One / Eight) + X / (OneAndHalf * ThirtyTwo);
- X = Z * Z;
- Exp2 = X * X;
- X = F9;
- Y = X - U1;
- printf("X: %.30f BInverse: %.30f Radix: %.30f Exp2: %.30f F9: %.30f U1 %.30f U2 %.30f F9: %.30f\n", X, BInvrse, Radix, Exp2, F9, U1, U2, F9);
- printf("Testing X^((X + 1) / (X - 1)) vs. exp(2) = %.17e as X -> 1.\n",
- Exp2);
- for(I = 1;;) {
- Z = X - BInvrse;
- Z = (X + One) / (Z - (One - BInvrse));
- Q = POW(X, Z) - Exp2;
- if (FABS(Q) > TwoForty * U2) {
- N = 1;
- V9 = (X - BInvrse) - (One - BInvrse);
- BadCond(Defect, "Calculated");
- printf(" %.17e for\n", POW(X,Z));
- printf("\t(1 + (%.17e) ^ (%.17e);\n", V9, Z);
- printf("\tdiffers from correct value by %.17e .\n", Q);
- printf("\tThis much error may spoil financial\n");
- printf("\tcalculations involving tiny interest rates.\n");
- break;
- }
- else {
- Z = (Y - X) * Two + Y;
- X = Y;
- Y = Z;
- Z = One + (X - F9)*(X - F9);
- if (Z > One && I < NoTrials) I++;
- else {
- if (X > One) {
- if (N == 0)
- printf("Accuracy seems adequate.\n");
- break;
- }
- else {
- X = One + U2;
- Y = U2 + U2;
- Y += X;
- I = 1;
- }
- }
- }
- }
- /*=============================================*/
- Milestone = 150;
- /*=============================================*/
- printf("Testing powers Z^Q at four nearly extreme values.\n");
- N = 0;
- Z = A1;
- Q = FLOOR(Half - LOG(C) / LOG(A1));
- Break = False;
- do {
- X = CInvrse;
- Y = POW(Z, Q);
- IsYeqX();
- Q = - Q;
- X = C;
- Y = POW(Z, Q);
- IsYeqX();
- if (Z < One) Break = True;
- else Z = AInvrse;
- } while ( ! (Break));
- PrintIfNPositive();
- if (N == 0) printf(" ... no discrepancies found.\n");
- printf("\n");
-
- /*=============================================*/
- Milestone = 160;
- /*=============================================*/
- Pause();
- printf("Searching for Overflow threshold:\n");
- printf("This may generate an error.\n");
- Y = - CInvrse;
- V9 = HInvrse * Y;
- sigsave = sigfpe;
- if (setjmp(ovfl_buf)) { I = 0; V9 = Y; goto overflow; }
- do {
- V = Y;
- Y = V9;
- V9 = HInvrse * Y;
- } while(V9 < Y);
- I = 1;
-overflow:
- sigsave = 0;
- Z = V9;
- printf("Can `Z = -Y' overflow?\n");
- printf("Trying it on Y = %.17e .\n", Y);
- V9 = - Y;
- V0 = V9;
- if (V - Y == V + V0) printf("Seems O.K.\n");
- else {
- printf("finds a ");
- BadCond(Flaw, "-(-Y) differs from Y.\n");
- }
- if (Z != Y) {
- BadCond(Serious, "");
- printf("overflow past %.17e\n\tshrinks to %.17e .\n", Y, Z);
- }
- if (I) {
- Y = V * (HInvrse * U2 - HInvrse);
- Z = Y + ((One - HInvrse) * U2) * V;
- if (Z < V0) Y = Z;
- if (Y < V0) V = Y;
- if (V0 - V < V0) V = V0;
- }
- else {
- V = Y * (HInvrse * U2 - HInvrse);
- V = V + ((One - HInvrse) * U2) * Y;
- }
- printf("Overflow threshold is V = %.17e .\n", V);
- if (I) printf("Overflow saturates at V0 = %.17e .\n", V0);
- else printf("There is no saturation value because \
-the system traps on overflow.\n");
- V9 = V * One;
- printf("No Overflow should be signaled for V * 1 = %.17e\n", V9);
- V9 = V / One;
- printf(" nor for V / 1 = %.17e .\n", V9);
- printf("Any overflow signal separating this * from the one\n");
- printf("above is a DEFECT.\n");
- /*=============================================*/
- Milestone = 170;
- /*=============================================*/
- if (!(-V < V && -V0 < V0 && -UfThold < V && UfThold < V)) {
- BadCond(Failure, "Comparisons involving ");
- printf("+-%g, +-%g\nand +-%g are confused by Overflow.",
- V, V0, UfThold);
- }
- /*=============================================*/
- Milestone = 175;
- /*=============================================*/
- printf("\n");
- for(Indx = 1; Indx <= 3; ++Indx) {
- switch (Indx) {
- case 1: Z = UfThold; break;
- case 2: Z = E0; break;
- case 3: Z = PseudoZero; break;
- }
- if (Z != Zero) {
- V9 = SQRT(Z);
- Y = V9 * V9;
- if (Y / (One - Radix * E9) < Z
- || Y > (One + Radix * E9) * Z) { /* dgh: + E9 --> * E9 */
- if (V9 > U1) BadCond(Serious, "");
- else BadCond(Defect, "");
- printf("Comparison alleges that what prints as Z = %.17e\n", Z);
- printf(" is too far from sqrt(Z) ^ 2 = %.17e .\n", Y);
- }
- }
- }
- /*=============================================*/
- Milestone = 180;
- /*=============================================*/
- for(Indx = 1; Indx <= 2; ++Indx) {
- if (Indx == 1) Z = V;
- else Z = V0;
- V9 = SQRT(Z);
- X = (One - Radix * E9) * V9;
- V9 = V9 * X;
- if (((V9 < (One - Two * Radix * E9) * Z) || (V9 > Z))) {
- Y = V9;
- if (X < W) BadCond(Serious, "");
- else BadCond(Defect, "");
- printf("Comparison alleges that Z = %17e\n", Z);
- printf(" is too far from sqrt(Z) ^ 2 (%.17e) .\n", Y);
- }
- }
- /*=============================================*/
- /*SPLIT
- }
-#include "paranoia.h"
-int part8(VOID){
-*/
- Milestone = 190;
- /*=============================================*/
- Pause();
- X = UfThold * V;
- Y = Radix * Radix;
- if (X*Y < One || X > Y) {
- if (X * Y < U1 || X > Y/U1) BadCond(Defect, "Badly");
- else BadCond(Flaw, "");
-
- printf(" unbalanced range; UfThold * V = %.17e\n\t%s\n",
- X, "is too far from 1.\n");
- }
- /*=============================================*/
- Milestone = 200;
- /*=============================================*/
- for (Indx = 1; Indx <= 5; ++Indx) {
- X = F9;
- switch (Indx) {
- case 2: X = One + U2; break;
- case 3: X = V; break;
- case 4: X = UfThold; break;
- case 5: X = Radix;
- }
- Y = X;
- sigsave = sigfpe;
- if (setjmp(ovfl_buf))
- printf(" X / X traps when X = %g\n", X);
- else {
- V9 = (Y / X - Half) - Half;
- if (V9 == Zero) continue;
- if (V9 == - U1 && Indx < 5) BadCond(Flaw, "");
- else BadCond(Serious, "");
- printf(" X / X differs from 1 when X = %.17e\n", X);
- printf(" instead, X / X - 1/2 - 1/2 = %.17e .\n", V9);
- }
- sigsave = 0;
- }
- /*=============================================*/
- Milestone = 210;
- /*=============================================*/
- MyZero = Zero;
- printf("\n");
- printf("What message and/or values does Division by Zero produce?\n") ;
-#ifndef NOPAUSE
- printf("This can interupt your program. You can ");
- printf("skip this part if you wish.\n");
- printf("Do you wish to compute 1 / 0? ");
- fflush(stdout);
- read (KEYBOARD, ch, 8);
- if ((ch[0] == 'Y') || (ch[0] == 'y')) {
-#endif
- sigsave = sigfpe;
- printf(" Trying to compute 1 / 0 produces ...");
- if (!setjmp(ovfl_buf)) printf(" %.7e .\n", One / MyZero);
- sigsave = 0;
-#ifndef NOPAUSE
- }
- else printf("O.K.\n");
- printf("\nDo you wish to compute 0 / 0? ");
- fflush(stdout);
- read (KEYBOARD, ch, 80);
- if ((ch[0] == 'Y') || (ch[0] == 'y')) {
-#endif
- sigsave = sigfpe;
- printf("\n Trying to compute 0 / 0 produces ...");
- if (!setjmp(ovfl_buf)) printf(" %.7e .\n", Zero / MyZero);
- sigsave = 0;
-#ifndef NOPAUSE
- }
- else printf("O.K.\n");
-#endif
- /*=============================================*/
- Milestone = 220;
- /*=============================================*/
- Pause();
- printf("\n");
- {
- static char *msg[] = {
- "FAILUREs encountered =",
- "SERIOUS DEFECTs discovered =",
- "DEFECTs discovered =",
- "FLAWs discovered =" };
- int i;
- for(i = 0; i < 4; i++) if (ErrCnt[i])
- printf("The number of %-29s %d.\n",
- msg[i], ErrCnt[i]);
- }
- printf("\n");
- if ((ErrCnt[Failure] + ErrCnt[Serious] + ErrCnt[Defect]
- + ErrCnt[Flaw]) > 0) {
- if ((ErrCnt[Failure] + ErrCnt[Serious] + ErrCnt[
- Defect] == 0) && (ErrCnt[Flaw] > 0)) {
- printf("The arithmetic diagnosed seems ");
- printf("Satisfactory though flawed.\n");
- }
- if ((ErrCnt[Failure] + ErrCnt[Serious] == 0)
- && ( ErrCnt[Defect] > 0)) {
- printf("The arithmetic diagnosed may be Acceptable\n");
- printf("despite inconvenient Defects.\n");
- }
- if ((ErrCnt[Failure] + ErrCnt[Serious]) > 0) {
- printf("The arithmetic diagnosed has ");
- printf("unacceptable Serious Defects.\n");
- }
- if (ErrCnt[Failure] > 0) {
- printf("Potentially fatal FAILURE may have spoiled this");
- printf(" program's subsequent diagnoses.\n");
- }
- }
- else {
- printf("No failures, defects nor flaws have been discovered.\n");
- if (! ((RMult == Rounded) && (RDiv == Rounded)
- && (RAddSub == Rounded) && (RSqrt == Rounded)))
- printf("The arithmetic diagnosed seems Satisfactory.\n");
- else {
- if (StickyBit >= One &&
- (Radix - Two) * (Radix - Nine - One) == Zero) {
- printf("Rounding appears to conform to ");
- printf("the proposed IEEE standard P");
- if ((Radix == Two) &&
- ((Precision - Four * Three * Two) *
- ( Precision - TwentySeven -
- TwentySeven + One) == Zero))
- printf("754");
- else printf("854");
- if (IEEE) printf(".\n");
- else {
- printf(",\nexcept for possibly Double Rounding");
- printf(" during Gradual Underflow.\n");
- }
- }
- printf("The arithmetic diagnosed appears to be Excellent!\n");
- }
- }
- if (fpecount)
- printf("\nA total of %d floating point exceptions were registered.\n",
- fpecount);
- printf("END OF TEST.\n");
- return 0;
- }
-
-/*SPLIT subs.c
-#include "paranoia.h"
-*/
-
- FLOAT
-Sign (FP X)
-#ifdef KR_headers
-FLOAT X;
-#endif
-{ return X >= (FLOAT)0. ? (FLOAT)1.0 : (FLOAT)-1.0; }
-
- void
-Pause(VOID)
-{
-#ifndef NOPAUSE
- char ch[8];
-
- printf("\nTo continue, press RETURN");
- fflush(stdout);
- read(KEYBOARD, ch, 8);
-#endif
- printf("\nDiagnosis resumes after milestone Number %d", Milestone);
- printf(" Page: %d\n\n", PageNo);
- ++Milestone;
- ++PageNo;
- }
-
- void
-TstCond (INT K, INT Valid, CHARP T)
-#ifdef KR_headers
-int K, Valid;
-char *T;
-#endif
-{ if (! Valid) { BadCond(K,T); printf(".\n"); } }
-
- void
-BadCond(INT K, CHARP T)
-#ifdef KR_headers
-int K;
-char *T;
-#endif
-{
- static char *msg[] = { "FAILURE", "SERIOUS DEFECT", "DEFECT", "FLAW" };
-
- ErrCnt [K] = ErrCnt [K] + 1;
- printf("%s: %s", msg[K], T);
- }
-
-
- FLOAT
-Random(VOID)
-/* Random computes
- X = (Random1 + Random9)^5
- Random1 = X - FLOOR(X) + 0.000005 * X;
- and returns the new value of Random1
-*/
-{
- FLOAT X, Y;
-
- X = Random1 + Random9;
- Y = X * X;
- Y = Y * Y;
- X = X * Y;
- Y = X - FLOOR(X);
- Random1 = Y + X * (FLOAT)0.000005;
- return(Random1);
- }
-
- void
-SqXMinX (INT ErrKind)
-#ifdef KR_headers
-int ErrKind;
-#endif
-{
- FLOAT XA, XB;
-
- XB = X * BInvrse;
- XA = X - XB;
- SqEr = ((SQRT(X * X) - XB) - XA) / OneUlp;
- if (SqEr != Zero) {
- if (SqEr < MinSqEr) MinSqEr = SqEr;
- if (SqEr > MaxSqEr) MaxSqEr = SqEr;
- J = J + 1.0;
- BadCond(ErrKind, "\n");
- printf("sqrt( %.17e) - %.17e = %.17e\n", X * X, X, OneUlp * SqEr);
- printf("\tinstead of correct value 0 .\n");
- }
- }
-
- void
-NewD(VOID)
-{
- X = Z1 * Q;
- X = FLOOR(Half - X / Radix) * Radix + X;
- Q = (Q - X * Z) / Radix + X * X * (D / Radix);
- Z = Z - Two * X * D;
- if (Z <= Zero) {
- Z = - Z;
- Z1 = - Z1;
- }
- D = Radix * D;
- }
-
- void
-SR3750(VOID)
-{
- if (! ((X - Radix < Z2 - Radix) || (X - Z2 > W - Z2))) {
- I = I + 1;
- X2 = SQRT(X * D);
- Y2 = (X2 - Z2) - (Y - Z2);
- X2 = X8 / (Y - Half);
- X2 = X2 - Half * X2 * X2;
- SqEr = (Y2 + Half) + (Half - X2);
- if (SqEr < MinSqEr) MinSqEr = SqEr;
- SqEr = Y2 - X2;
- if (SqEr > MaxSqEr) MaxSqEr = SqEr;
- }
- }
-
- void
-IsYeqX(VOID)
-{
- if (Y != X) {
- if (N <= 0) {
- if (Z == Zero && Q <= Zero)
- printf("WARNING: computing\n");
- else BadCond(Defect, "computing\n");
- printf("\t(%.17e) ^ (%.17e)\n", Z, Q);
- printf("\tyielded %.17e;\n", Y);
- printf("\twhich compared unequal to correct %.17e ;\n",
- X);
- printf("\t\tthey differ by %.17e .\n", Y - X);
- }
- N = N + 1; /* ... count discrepancies. */
- }
- }
-
- void
-SR3980(VOID)
-{
- do {
- Q = (FLOAT) I;
- Y = POW(Z, Q);
- IsYeqX();
- if (++I > M) break;
- X = Z * X;
- } while ( X < W );
- }
-
- void
-PrintIfNPositive(VOID)
-{
- if (N > 0) printf("Similar discrepancies have occurred %d times.\n", N);
- }
-
- void
-TstPtUf(VOID)
-{
- N = 0;
- if (Z != Zero) {
- printf("Since comparison denies Z = 0, evaluating ");
- printf("(Z + Z) / Z should be safe.\n");
- sigsave = sigfpe;
- if (setjmp(ovfl_buf)) goto very_serious;
- Q9 = (Z + Z) / Z;
- printf("What the machine gets for (Z + Z) / Z is %.17e .\n",
- Q9);
- if (FABS(Q9 - Two) < Radix * U2) {
- printf("This is O.K., provided Over/Underflow");
- printf(" has NOT just been signaled.\n");
- }
- else {
- if ((Q9 < One) || (Q9 > Two)) {
-very_serious:
- N = 1;
- ErrCnt [Serious] = ErrCnt [Serious] + 1;
- printf("This is a VERY SERIOUS DEFECT!\n");
- }
- else {
- N = 1;
- ErrCnt [Defect] = ErrCnt [Defect] + 1;
- printf("This is a DEFECT!\n");
- }
- }
- sigsave = 0;
- V9 = Z * One;
- Random1 = V9;
- V9 = One * Z;
- Random2 = V9;
- V9 = Z / One;
- if ((Z == Random1) && (Z == Random2) && (Z == V9)) {
- if (N > 0) Pause();
- }
- else {
- N = 1;
- BadCond(Defect, "What prints as Z = ");
- printf("%.17e\n\tcompares different from ", Z);
- if (Z != Random1) printf("Z * 1 = %.17e ", Random1);
- if (! ((Z == Random2)
- || (Random2 == Random1)))
- printf("1 * Z == %g\n", Random2);
- if (! (Z == V9)) printf("Z / 1 = %.17e\n", V9);
- if (Random2 != Random1) {
- ErrCnt [Defect] = ErrCnt [Defect] + 1;
- BadCond(Defect, "Multiplication does not commute!\n");
- printf("\tComparison alleges that 1 * Z = %.17e\n",
- Random2);
- printf("\tdiffers from Z * 1 = %.17e\n", Random1);
- }
- Pause();
- }
- }
- }
-
- void
-notify(CHARP s)
-#ifdef KR_headers
- char *s;
-#endif
-{
- printf("%s test appears to be inconsistent...\n", s);
- printf(" PLEASE NOTIFY KARPINKSI!\n");
- }
-
-/*SPLIT msgs.c
-#include "paranoia.h"
-*/
-
- void
-msglist(CHARPP s)
-#ifdef KR_headers
-char **s;
-#endif
-{ while(*s) printf("%s\n", *s++); }
-
- void
-Instructions(VOID)
-{
- static char *instr[] = {
- "Lest this program stop prematurely, i.e. before displaying\n",
- " `END OF TEST',\n",
- "try to persuade the computer NOT to terminate execution when an",
- "error like Over/Underflow or Division by Zero occurs, but rather",
- "to persevere with a surrogate value after, perhaps, displaying some",
- "warning. If persuasion avails naught, don't despair but run this",
- "program anyway to see how many milestones it passes, and then",
- "amend it to make further progress.\n",
- "Answer questions with Y, y, N or n (unless otherwise indicated).\n",
- 0};
-
- msglist(instr);
- }
-
- void
-Heading(VOID)
-{
- static char *head[] = {
- "Users are invited to help debug and augment this program so it will",
- "cope with unanticipated and newly uncovered arithmetic pathologies.\n",
- "Please send suggestions and interesting results to",
- "\tRichard Karpinski",
- "\tComputer Center U-76",
- "\tUniversity of California",
- "\tSan Francisco, CA 94143-0704, USA\n",
- "In doing so, please include the following information:",
-#ifdef Single
- "\tPrecision:\tsingle;",
-#else
- "\tPrecision:\tdouble;",
-#endif
- "\tVersion:\t10 February 1989;",
- "\tComputer:\n",
- "\tCompiler:\n",
- "\tOptimization level:\n",
- "\tOther relevant compiler options:",
- 0};
-
- msglist(head);
- }
-
- void
-Characteristics(VOID)
-{
- static char *chars[] = {
- "Running this program should reveal these characteristics:",
- " Radix = 1, 2, 4, 8, 10, 16, 100, 256 ...",
- " Precision = number of significant digits carried.",
- " U2 = Radix/Radix^Precision = One Ulp",
- "\t(OneUlpnit in the Last Place) of 1.000xxx .",
- " U1 = 1/Radix^Precision = One Ulp of numbers a little less than 1.0 .",
- " Adequacy of guard digits for Mult., Div. and Subt.",
- " Whether arithmetic is chopped, correctly rounded, or something else",
- "\tfor Mult., Div., Add/Subt. and Sqrt.",
- " Whether a Sticky Bit used correctly for rounding.",
- " UnderflowThreshold = an underflow threshold.",
- " E0 and PseudoZero tell whether underflow is abrupt, gradual, or fuzzy.",
- " V = an overflow threshold, roughly.",
- " V0 tells, roughly, whether Infinity is represented.",
- " Comparisions are checked for consistency with subtraction",
- "\tand for contamination with pseudo-zeros.",
- " Sqrt is tested. Y^X is not tested.",
- " Extra-precise subexpressions are revealed but NOT YET tested.",
- " Decimal-Binary conversion is NOT YET tested for accuracy.",
- 0};
-
- msglist(chars);
- }
-
- void
-History(VOID)
-{ /* History */
- /* Converted from Brian Wichmann's Pascal version to C by Thos Sumner,
- with further massaging by David M. Gay. */
-
- static char *hist[] = {
- "The program attempts to discriminate among",
- " FLAWs, like lack of a sticky bit,",
- " Serious DEFECTs, like lack of a guard digit, and",
- " FAILUREs, like 2+2 == 5 .",
- "Failures may confound subsequent diagnoses.\n",
- "The diagnostic capabilities of this program go beyond an earlier",
- "program called `MACHAR', which can be found at the end of the",
- "book `Software Manual for the Elementary Functions' (1980) by",
- "W. J. Cody and W. Waite. Although both programs try to discover",
- "the Radix, Precision and range (over/underflow thresholds)",
- "of the arithmetic, this program tries to cope with a wider variety",
- "of pathologies, and to say how well the arithmetic is implemented.",
- "\nThe program is based upon a conventional radix representation for",
- "floating-point numbers, but also allows logarithmic encoding",
- "as used by certain early WANG machines.\n",
- "BASIC version of this program (C) 1983 by Prof. W. M. Kahan;",
- "see source comments for more history.",
- 0};
-
- msglist(hist);
- }
+++ /dev/null
-/* Twofish for GPG
- * Copyright (C) 1998, 2002, 2003 Free Software Foundation, Inc.
- * Written by Matthew Skala <mskala@ansuz.sooke.bc.ca>, July 26, 1998
- * 256-bit key length added March 20, 1999
- * Some modifications to reduce the text size by Werner Koch, April, 1998
- *
- * This file is part of Libgcrypt.
- *
- * Libgcrypt is free software; you can redistribute it and/or modify
- * it under the terms of the GNU Lesser General Public License as
- * published by the Free Software Foundation; either version 2.1 of
- * the License, or (at your option) any later version.
- *
- * Libgcrypt is distributed in the hope that it will be useful,
- * but WITHOUT ANY WARRANTY; without even the implied warranty of
- * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
- * GNU Lesser General Public License for more details.
- *
- * You should have received a copy of the GNU Lesser General Public
- * License along with this program; if not, write to the Free Software
- * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA
- ********************************************************************
- *
- * This code is a "clean room" implementation, written from the paper
- * _Twofish: A 128-Bit Block Cipher_ by Bruce Schneier, John Kelsey,
- * Doug Whiting, David Wagner, Chris Hall, and Niels Ferguson, available
- * through http://www.counterpane.com/twofish.html
- *
- * For background information on multiplication in finite fields, used for
- * the matrix operations in the key schedule, see the book _Contemporary
- * Abstract Algebra_ by Joseph A. Gallian, especially chapter 22 in the
- * Third Edition.
- *
- * Only the 128- and 256-bit key sizes are supported. This code is intended
- * for GNU C on a 32-bit system, but it should work almost anywhere. Loops
- * are unrolled, precomputation tables are used, etc., for maximum speed at
- * some cost in memory consumption. */
-
-//#include <config.h>
-#include <stdio.h>
-#include <stdlib.h>
-#include <string.h> /* for memcmp() */
-
-//#include "types.h" /* for byte and u32 typedefs */
-//#include "g10lib.h"
-//#include "cipher.h"
-
-/* Prototype for the self-test function. */
-//static const char *selftest(void);
-
-typedef unsigned int u32;
-typedef unsigned char byte;
-
-/* Structure for an expanded Twofish key. s contains the key-dependent
- * S-boxes composed with the MDS matrix; w contains the eight "whitening"
- * subkeys, K[0] through K[7]. k holds the remaining, "round" subkeys. Note
- * that k[i] corresponds to what the Twofish paper calls K[i+8]. */
-typedef struct {
- u32 s[4][256], w[8], k[32];
-} TWOFISH_context;
-\f
-/* These two tables are the q0 and q1 permutations, exactly as described in
- * the Twofish paper. */
-
-static const byte q0[256] = {
- 0xA9, 0x67, 0xB3, 0xE8, 0x04, 0xFD, 0xA3, 0x76, 0x9A, 0x92, 0x80, 0x78,
- 0xE4, 0xDD, 0xD1, 0x38, 0x0D, 0xC6, 0x35, 0x98, 0x18, 0xF7, 0xEC, 0x6C,
- 0x43, 0x75, 0x37, 0x26, 0xFA, 0x13, 0x94, 0x48, 0xF2, 0xD0, 0x8B, 0x30,
- 0x84, 0x54, 0xDF, 0x23, 0x19, 0x5B, 0x3D, 0x59, 0xF3, 0xAE, 0xA2, 0x82,
- 0x63, 0x01, 0x83, 0x2E, 0xD9, 0x51, 0x9B, 0x7C, 0xA6, 0xEB, 0xA5, 0xBE,
- 0x16, 0x0C, 0xE3, 0x61, 0xC0, 0x8C, 0x3A, 0xF5, 0x73, 0x2C, 0x25, 0x0B,
- 0xBB, 0x4E, 0x89, 0x6B, 0x53, 0x6A, 0xB4, 0xF1, 0xE1, 0xE6, 0xBD, 0x45,
- 0xE2, 0xF4, 0xB6, 0x66, 0xCC, 0x95, 0x03, 0x56, 0xD4, 0x1C, 0x1E, 0xD7,
- 0xFB, 0xC3, 0x8E, 0xB5, 0xE9, 0xCF, 0xBF, 0xBA, 0xEA, 0x77, 0x39, 0xAF,
- 0x33, 0xC9, 0x62, 0x71, 0x81, 0x79, 0x09, 0xAD, 0x24, 0xCD, 0xF9, 0xD8,
- 0xE5, 0xC5, 0xB9, 0x4D, 0x44, 0x08, 0x86, 0xE7, 0xA1, 0x1D, 0xAA, 0xED,
- 0x06, 0x70, 0xB2, 0xD2, 0x41, 0x7B, 0xA0, 0x11, 0x31, 0xC2, 0x27, 0x90,
- 0x20, 0xF6, 0x60, 0xFF, 0x96, 0x5C, 0xB1, 0xAB, 0x9E, 0x9C, 0x52, 0x1B,
- 0x5F, 0x93, 0x0A, 0xEF, 0x91, 0x85, 0x49, 0xEE, 0x2D, 0x4F, 0x8F, 0x3B,
- 0x47, 0x87, 0x6D, 0x46, 0xD6, 0x3E, 0x69, 0x64, 0x2A, 0xCE, 0xCB, 0x2F,
- 0xFC, 0x97, 0x05, 0x7A, 0xAC, 0x7F, 0xD5, 0x1A, 0x4B, 0x0E, 0xA7, 0x5A,
- 0x28, 0x14, 0x3F, 0x29, 0x88, 0x3C, 0x4C, 0x02, 0xB8, 0xDA, 0xB0, 0x17,
- 0x55, 0x1F, 0x8A, 0x7D, 0x57, 0xC7, 0x8D, 0x74, 0xB7, 0xC4, 0x9F, 0x72,
- 0x7E, 0x15, 0x22, 0x12, 0x58, 0x07, 0x99, 0x34, 0x6E, 0x50, 0xDE, 0x68,
- 0x65, 0xBC, 0xDB, 0xF8, 0xC8, 0xA8, 0x2B, 0x40, 0xDC, 0xFE, 0x32, 0xA4,
- 0xCA, 0x10, 0x21, 0xF0, 0xD3, 0x5D, 0x0F, 0x00, 0x6F, 0x9D, 0x36, 0x42,
- 0x4A, 0x5E, 0xC1, 0xE0
-};
-
-static const byte q1[256] = {
- 0x75, 0xF3, 0xC6, 0xF4, 0xDB, 0x7B, 0xFB, 0xC8, 0x4A, 0xD3, 0xE6, 0x6B,
- 0x45, 0x7D, 0xE8, 0x4B, 0xD6, 0x32, 0xD8, 0xFD, 0x37, 0x71, 0xF1, 0xE1,
- 0x30, 0x0F, 0xF8, 0x1B, 0x87, 0xFA, 0x06, 0x3F, 0x5E, 0xBA, 0xAE, 0x5B,
- 0x8A, 0x00, 0xBC, 0x9D, 0x6D, 0xC1, 0xB1, 0x0E, 0x80, 0x5D, 0xD2, 0xD5,
- 0xA0, 0x84, 0x07, 0x14, 0xB5, 0x90, 0x2C, 0xA3, 0xB2, 0x73, 0x4C, 0x54,
- 0x92, 0x74, 0x36, 0x51, 0x38, 0xB0, 0xBD, 0x5A, 0xFC, 0x60, 0x62, 0x96,
- 0x6C, 0x42, 0xF7, 0x10, 0x7C, 0x28, 0x27, 0x8C, 0x13, 0x95, 0x9C, 0xC7,
- 0x24, 0x46, 0x3B, 0x70, 0xCA, 0xE3, 0x85, 0xCB, 0x11, 0xD0, 0x93, 0xB8,
- 0xA6, 0x83, 0x20, 0xFF, 0x9F, 0x77, 0xC3, 0xCC, 0x03, 0x6F, 0x08, 0xBF,
- 0x40, 0xE7, 0x2B, 0xE2, 0x79, 0x0C, 0xAA, 0x82, 0x41, 0x3A, 0xEA, 0xB9,
- 0xE4, 0x9A, 0xA4, 0x97, 0x7E, 0xDA, 0x7A, 0x17, 0x66, 0x94, 0xA1, 0x1D,
- 0x3D, 0xF0, 0xDE, 0xB3, 0x0B, 0x72, 0xA7, 0x1C, 0xEF, 0xD1, 0x53, 0x3E,
- 0x8F, 0x33, 0x26, 0x5F, 0xEC, 0x76, 0x2A, 0x49, 0x81, 0x88, 0xEE, 0x21,
- 0xC4, 0x1A, 0xEB, 0xD9, 0xC5, 0x39, 0x99, 0xCD, 0xAD, 0x31, 0x8B, 0x01,
- 0x18, 0x23, 0xDD, 0x1F, 0x4E, 0x2D, 0xF9, 0x48, 0x4F, 0xF2, 0x65, 0x8E,
- 0x78, 0x5C, 0x58, 0x19, 0x8D, 0xE5, 0x98, 0x57, 0x67, 0x7F, 0x05, 0x64,
- 0xAF, 0x63, 0xB6, 0xFE, 0xF5, 0xB7, 0x3C, 0xA5, 0xCE, 0xE9, 0x68, 0x44,
- 0xE0, 0x4D, 0x43, 0x69, 0x29, 0x2E, 0xAC, 0x15, 0x59, 0xA8, 0x0A, 0x9E,
- 0x6E, 0x47, 0xDF, 0x34, 0x35, 0x6A, 0xCF, 0xDC, 0x22, 0xC9, 0xC0, 0x9B,
- 0x89, 0xD4, 0xED, 0xAB, 0x12, 0xA2, 0x0D, 0x52, 0xBB, 0x02, 0x2F, 0xA9,
- 0xD7, 0x61, 0x1E, 0xB4, 0x50, 0x04, 0xF6, 0xC2, 0x16, 0x25, 0x86, 0x56,
- 0x55, 0x09, 0xBE, 0x91
-};
-\f
-/* These MDS tables are actually tables of MDS composed with q0 and q1,
- * because it is only ever used that way and we can save some time by
- * precomputing. Of course the main saving comes from precomputing the
- * GF(2^8) multiplication involved in the MDS matrix multiply; by looking
- * things up in these tables we reduce the matrix multiply to four lookups
- * and three XORs. Semi-formally, the definition of these tables is:
- * mds[0][i] = MDS (q1[i] 0 0 0)^T mds[1][i] = MDS (0 q0[i] 0 0)^T
- * mds[2][i] = MDS (0 0 q1[i] 0)^T mds[3][i] = MDS (0 0 0 q0[i])^T
- * where ^T means "transpose", the matrix multiply is performed in GF(2^8)
- * represented as GF(2)[x]/v(x) where v(x)=x^8+x^6+x^5+x^3+1 as described
- * by Schneier et al, and I'm casually glossing over the byte/word
- * conversion issues. */
-
-static const u32 mds[4][256] = {
- {0xBCBC3275, 0xECEC21F3, 0x202043C6, 0xB3B3C9F4, 0xDADA03DB, 0x02028B7B,
- 0xE2E22BFB, 0x9E9EFAC8, 0xC9C9EC4A, 0xD4D409D3, 0x18186BE6, 0x1E1E9F6B,
- 0x98980E45, 0xB2B2387D, 0xA6A6D2E8, 0x2626B74B, 0x3C3C57D6, 0x93938A32,
- 0x8282EED8, 0x525298FD, 0x7B7BD437, 0xBBBB3771, 0x5B5B97F1, 0x474783E1,
- 0x24243C30, 0x5151E20F, 0xBABAC6F8, 0x4A4AF31B, 0xBFBF4887, 0x0D0D70FA,
- 0xB0B0B306, 0x7575DE3F, 0xD2D2FD5E, 0x7D7D20BA, 0x666631AE, 0x3A3AA35B,
- 0x59591C8A, 0x00000000, 0xCDCD93BC, 0x1A1AE09D, 0xAEAE2C6D, 0x7F7FABC1,
- 0x2B2BC7B1, 0xBEBEB90E, 0xE0E0A080, 0x8A8A105D, 0x3B3B52D2, 0x6464BAD5,
- 0xD8D888A0, 0xE7E7A584, 0x5F5FE807, 0x1B1B1114, 0x2C2CC2B5, 0xFCFCB490,
- 0x3131272C, 0x808065A3, 0x73732AB2, 0x0C0C8173, 0x79795F4C, 0x6B6B4154,
- 0x4B4B0292, 0x53536974, 0x94948F36, 0x83831F51, 0x2A2A3638, 0xC4C49CB0,
- 0x2222C8BD, 0xD5D5F85A, 0xBDBDC3FC, 0x48487860, 0xFFFFCE62, 0x4C4C0796,
- 0x4141776C, 0xC7C7E642, 0xEBEB24F7, 0x1C1C1410, 0x5D5D637C, 0x36362228,
- 0x6767C027, 0xE9E9AF8C, 0x4444F913, 0x1414EA95, 0xF5F5BB9C, 0xCFCF18C7,
- 0x3F3F2D24, 0xC0C0E346, 0x7272DB3B, 0x54546C70, 0x29294CCA, 0xF0F035E3,
- 0x0808FE85, 0xC6C617CB, 0xF3F34F11, 0x8C8CE4D0, 0xA4A45993, 0xCACA96B8,
- 0x68683BA6, 0xB8B84D83, 0x38382820, 0xE5E52EFF, 0xADAD569F, 0x0B0B8477,
- 0xC8C81DC3, 0x9999FFCC, 0x5858ED03, 0x19199A6F, 0x0E0E0A08, 0x95957EBF,
- 0x70705040, 0xF7F730E7, 0x6E6ECF2B, 0x1F1F6EE2, 0xB5B53D79, 0x09090F0C,
- 0x616134AA, 0x57571682, 0x9F9F0B41, 0x9D9D803A, 0x111164EA, 0x2525CDB9,
- 0xAFAFDDE4, 0x4545089A, 0xDFDF8DA4, 0xA3A35C97, 0xEAEAD57E, 0x353558DA,
- 0xEDEDD07A, 0x4343FC17, 0xF8F8CB66, 0xFBFBB194, 0x3737D3A1, 0xFAFA401D,
- 0xC2C2683D, 0xB4B4CCF0, 0x32325DDE, 0x9C9C71B3, 0x5656E70B, 0xE3E3DA72,
- 0x878760A7, 0x15151B1C, 0xF9F93AEF, 0x6363BFD1, 0x3434A953, 0x9A9A853E,
- 0xB1B1428F, 0x7C7CD133, 0x88889B26, 0x3D3DA65F, 0xA1A1D7EC, 0xE4E4DF76,
- 0x8181942A, 0x91910149, 0x0F0FFB81, 0xEEEEAA88, 0x161661EE, 0xD7D77321,
- 0x9797F5C4, 0xA5A5A81A, 0xFEFE3FEB, 0x6D6DB5D9, 0x7878AEC5, 0xC5C56D39,
- 0x1D1DE599, 0x7676A4CD, 0x3E3EDCAD, 0xCBCB6731, 0xB6B6478B, 0xEFEF5B01,
- 0x12121E18, 0x6060C523, 0x6A6AB0DD, 0x4D4DF61F, 0xCECEE94E, 0xDEDE7C2D,
- 0x55559DF9, 0x7E7E5A48, 0x2121B24F, 0x03037AF2, 0xA0A02665, 0x5E5E198E,
- 0x5A5A6678, 0x65654B5C, 0x62624E58, 0xFDFD4519, 0x0606F48D, 0x404086E5,
- 0xF2F2BE98, 0x3333AC57, 0x17179067, 0x05058E7F, 0xE8E85E05, 0x4F4F7D64,
- 0x89896AAF, 0x10109563, 0x74742FB6, 0x0A0A75FE, 0x5C5C92F5, 0x9B9B74B7,
- 0x2D2D333C, 0x3030D6A5, 0x2E2E49CE, 0x494989E9, 0x46467268, 0x77775544,
- 0xA8A8D8E0, 0x9696044D, 0x2828BD43, 0xA9A92969, 0xD9D97929, 0x8686912E,
- 0xD1D187AC, 0xF4F44A15, 0x8D8D1559, 0xD6D682A8, 0xB9B9BC0A, 0x42420D9E,
- 0xF6F6C16E, 0x2F2FB847, 0xDDDD06DF, 0x23233934, 0xCCCC6235, 0xF1F1C46A,
- 0xC1C112CF, 0x8585EBDC, 0x8F8F9E22, 0x7171A1C9, 0x9090F0C0, 0xAAAA539B,
- 0x0101F189, 0x8B8BE1D4, 0x4E4E8CED, 0x8E8E6FAB, 0xABABA212, 0x6F6F3EA2,
- 0xE6E6540D, 0xDBDBF252, 0x92927BBB, 0xB7B7B602, 0x6969CA2F, 0x3939D9A9,
- 0xD3D30CD7, 0xA7A72361, 0xA2A2AD1E, 0xC3C399B4, 0x6C6C4450, 0x07070504,
- 0x04047FF6, 0x272746C2, 0xACACA716, 0xD0D07625, 0x50501386, 0xDCDCF756,
- 0x84841A55, 0xE1E15109, 0x7A7A25BE, 0x1313EF91},
-
- {0xA9D93939, 0x67901717, 0xB3719C9C, 0xE8D2A6A6, 0x04050707, 0xFD985252,
- 0xA3658080, 0x76DFE4E4, 0x9A084545, 0x92024B4B, 0x80A0E0E0, 0x78665A5A,
- 0xE4DDAFAF, 0xDDB06A6A, 0xD1BF6363, 0x38362A2A, 0x0D54E6E6, 0xC6432020,
- 0x3562CCCC, 0x98BEF2F2, 0x181E1212, 0xF724EBEB, 0xECD7A1A1, 0x6C774141,
- 0x43BD2828, 0x7532BCBC, 0x37D47B7B, 0x269B8888, 0xFA700D0D, 0x13F94444,
- 0x94B1FBFB, 0x485A7E7E, 0xF27A0303, 0xD0E48C8C, 0x8B47B6B6, 0x303C2424,
- 0x84A5E7E7, 0x54416B6B, 0xDF06DDDD, 0x23C56060, 0x1945FDFD, 0x5BA33A3A,
- 0x3D68C2C2, 0x59158D8D, 0xF321ECEC, 0xAE316666, 0xA23E6F6F, 0x82165757,
- 0x63951010, 0x015BEFEF, 0x834DB8B8, 0x2E918686, 0xD9B56D6D, 0x511F8383,
- 0x9B53AAAA, 0x7C635D5D, 0xA63B6868, 0xEB3FFEFE, 0xA5D63030, 0xBE257A7A,
- 0x16A7ACAC, 0x0C0F0909, 0xE335F0F0, 0x6123A7A7, 0xC0F09090, 0x8CAFE9E9,
- 0x3A809D9D, 0xF5925C5C, 0x73810C0C, 0x2C273131, 0x2576D0D0, 0x0BE75656,
- 0xBB7B9292, 0x4EE9CECE, 0x89F10101, 0x6B9F1E1E, 0x53A93434, 0x6AC4F1F1,
- 0xB499C3C3, 0xF1975B5B, 0xE1834747, 0xE66B1818, 0xBDC82222, 0x450E9898,
- 0xE26E1F1F, 0xF4C9B3B3, 0xB62F7474, 0x66CBF8F8, 0xCCFF9999, 0x95EA1414,
- 0x03ED5858, 0x56F7DCDC, 0xD4E18B8B, 0x1C1B1515, 0x1EADA2A2, 0xD70CD3D3,
- 0xFB2BE2E2, 0xC31DC8C8, 0x8E195E5E, 0xB5C22C2C, 0xE9894949, 0xCF12C1C1,
- 0xBF7E9595, 0xBA207D7D, 0xEA641111, 0x77840B0B, 0x396DC5C5, 0xAF6A8989,
- 0x33D17C7C, 0xC9A17171, 0x62CEFFFF, 0x7137BBBB, 0x81FB0F0F, 0x793DB5B5,
- 0x0951E1E1, 0xADDC3E3E, 0x242D3F3F, 0xCDA47676, 0xF99D5555, 0xD8EE8282,
- 0xE5864040, 0xC5AE7878, 0xB9CD2525, 0x4D049696, 0x44557777, 0x080A0E0E,
- 0x86135050, 0xE730F7F7, 0xA1D33737, 0x1D40FAFA, 0xAA346161, 0xED8C4E4E,
- 0x06B3B0B0, 0x706C5454, 0xB22A7373, 0xD2523B3B, 0x410B9F9F, 0x7B8B0202,
- 0xA088D8D8, 0x114FF3F3, 0x3167CBCB, 0xC2462727, 0x27C06767, 0x90B4FCFC,
- 0x20283838, 0xF67F0404, 0x60784848, 0xFF2EE5E5, 0x96074C4C, 0x5C4B6565,
- 0xB1C72B2B, 0xAB6F8E8E, 0x9E0D4242, 0x9CBBF5F5, 0x52F2DBDB, 0x1BF34A4A,
- 0x5FA63D3D, 0x9359A4A4, 0x0ABCB9B9, 0xEF3AF9F9, 0x91EF1313, 0x85FE0808,
- 0x49019191, 0xEE611616, 0x2D7CDEDE, 0x4FB22121, 0x8F42B1B1, 0x3BDB7272,
- 0x47B82F2F, 0x8748BFBF, 0x6D2CAEAE, 0x46E3C0C0, 0xD6573C3C, 0x3E859A9A,
- 0x6929A9A9, 0x647D4F4F, 0x2A948181, 0xCE492E2E, 0xCB17C6C6, 0x2FCA6969,
- 0xFCC3BDBD, 0x975CA3A3, 0x055EE8E8, 0x7AD0EDED, 0xAC87D1D1, 0x7F8E0505,
- 0xD5BA6464, 0x1AA8A5A5, 0x4BB72626, 0x0EB9BEBE, 0xA7608787, 0x5AF8D5D5,
- 0x28223636, 0x14111B1B, 0x3FDE7575, 0x2979D9D9, 0x88AAEEEE, 0x3C332D2D,
- 0x4C5F7979, 0x02B6B7B7, 0xB896CACA, 0xDA583535, 0xB09CC4C4, 0x17FC4343,
- 0x551A8484, 0x1FF64D4D, 0x8A1C5959, 0x7D38B2B2, 0x57AC3333, 0xC718CFCF,
- 0x8DF40606, 0x74695353, 0xB7749B9B, 0xC4F59797, 0x9F56ADAD, 0x72DAE3E3,
- 0x7ED5EAEA, 0x154AF4F4, 0x229E8F8F, 0x12A2ABAB, 0x584E6262, 0x07E85F5F,
- 0x99E51D1D, 0x34392323, 0x6EC1F6F6, 0x50446C6C, 0xDE5D3232, 0x68724646,
- 0x6526A0A0, 0xBC93CDCD, 0xDB03DADA, 0xF8C6BABA, 0xC8FA9E9E, 0xA882D6D6,
- 0x2BCF6E6E, 0x40507070, 0xDCEB8585, 0xFE750A0A, 0x328A9393, 0xA48DDFDF,
- 0xCA4C2929, 0x10141C1C, 0x2173D7D7, 0xF0CCB4B4, 0xD309D4D4, 0x5D108A8A,
- 0x0FE25151, 0x00000000, 0x6F9A1919, 0x9DE01A1A, 0x368F9494, 0x42E6C7C7,
- 0x4AECC9C9, 0x5EFDD2D2, 0xC1AB7F7F, 0xE0D8A8A8},
-
- {0xBC75BC32, 0xECF3EC21, 0x20C62043, 0xB3F4B3C9, 0xDADBDA03, 0x027B028B,
- 0xE2FBE22B, 0x9EC89EFA, 0xC94AC9EC, 0xD4D3D409, 0x18E6186B, 0x1E6B1E9F,
- 0x9845980E, 0xB27DB238, 0xA6E8A6D2, 0x264B26B7, 0x3CD63C57, 0x9332938A,
- 0x82D882EE, 0x52FD5298, 0x7B377BD4, 0xBB71BB37, 0x5BF15B97, 0x47E14783,
- 0x2430243C, 0x510F51E2, 0xBAF8BAC6, 0x4A1B4AF3, 0xBF87BF48, 0x0DFA0D70,
- 0xB006B0B3, 0x753F75DE, 0xD25ED2FD, 0x7DBA7D20, 0x66AE6631, 0x3A5B3AA3,
- 0x598A591C, 0x00000000, 0xCDBCCD93, 0x1A9D1AE0, 0xAE6DAE2C, 0x7FC17FAB,
- 0x2BB12BC7, 0xBE0EBEB9, 0xE080E0A0, 0x8A5D8A10, 0x3BD23B52, 0x64D564BA,
- 0xD8A0D888, 0xE784E7A5, 0x5F075FE8, 0x1B141B11, 0x2CB52CC2, 0xFC90FCB4,
- 0x312C3127, 0x80A38065, 0x73B2732A, 0x0C730C81, 0x794C795F, 0x6B546B41,
- 0x4B924B02, 0x53745369, 0x9436948F, 0x8351831F, 0x2A382A36, 0xC4B0C49C,
- 0x22BD22C8, 0xD55AD5F8, 0xBDFCBDC3, 0x48604878, 0xFF62FFCE, 0x4C964C07,
- 0x416C4177, 0xC742C7E6, 0xEBF7EB24, 0x1C101C14, 0x5D7C5D63, 0x36283622,
- 0x672767C0, 0xE98CE9AF, 0x441344F9, 0x149514EA, 0xF59CF5BB, 0xCFC7CF18,
- 0x3F243F2D, 0xC046C0E3, 0x723B72DB, 0x5470546C, 0x29CA294C, 0xF0E3F035,
- 0x088508FE, 0xC6CBC617, 0xF311F34F, 0x8CD08CE4, 0xA493A459, 0xCAB8CA96,
- 0x68A6683B, 0xB883B84D, 0x38203828, 0xE5FFE52E, 0xAD9FAD56, 0x0B770B84,
- 0xC8C3C81D, 0x99CC99FF, 0x580358ED, 0x196F199A, 0x0E080E0A, 0x95BF957E,
- 0x70407050, 0xF7E7F730, 0x6E2B6ECF, 0x1FE21F6E, 0xB579B53D, 0x090C090F,
- 0x61AA6134, 0x57825716, 0x9F419F0B, 0x9D3A9D80, 0x11EA1164, 0x25B925CD,
- 0xAFE4AFDD, 0x459A4508, 0xDFA4DF8D, 0xA397A35C, 0xEA7EEAD5, 0x35DA3558,
- 0xED7AEDD0, 0x431743FC, 0xF866F8CB, 0xFB94FBB1, 0x37A137D3, 0xFA1DFA40,
- 0xC23DC268, 0xB4F0B4CC, 0x32DE325D, 0x9CB39C71, 0x560B56E7, 0xE372E3DA,
- 0x87A78760, 0x151C151B, 0xF9EFF93A, 0x63D163BF, 0x345334A9, 0x9A3E9A85,
- 0xB18FB142, 0x7C337CD1, 0x8826889B, 0x3D5F3DA6, 0xA1ECA1D7, 0xE476E4DF,
- 0x812A8194, 0x91499101, 0x0F810FFB, 0xEE88EEAA, 0x16EE1661, 0xD721D773,
- 0x97C497F5, 0xA51AA5A8, 0xFEEBFE3F, 0x6DD96DB5, 0x78C578AE, 0xC539C56D,
- 0x1D991DE5, 0x76CD76A4, 0x3EAD3EDC, 0xCB31CB67, 0xB68BB647, 0xEF01EF5B,
- 0x1218121E, 0x602360C5, 0x6ADD6AB0, 0x4D1F4DF6, 0xCE4ECEE9, 0xDE2DDE7C,
- 0x55F9559D, 0x7E487E5A, 0x214F21B2, 0x03F2037A, 0xA065A026, 0x5E8E5E19,
- 0x5A785A66, 0x655C654B, 0x6258624E, 0xFD19FD45, 0x068D06F4, 0x40E54086,
- 0xF298F2BE, 0x335733AC, 0x17671790, 0x057F058E, 0xE805E85E, 0x4F644F7D,
- 0x89AF896A, 0x10631095, 0x74B6742F, 0x0AFE0A75, 0x5CF55C92, 0x9BB79B74,
- 0x2D3C2D33, 0x30A530D6, 0x2ECE2E49, 0x49E94989, 0x46684672, 0x77447755,
- 0xA8E0A8D8, 0x964D9604, 0x284328BD, 0xA969A929, 0xD929D979, 0x862E8691,
- 0xD1ACD187, 0xF415F44A, 0x8D598D15, 0xD6A8D682, 0xB90AB9BC, 0x429E420D,
- 0xF66EF6C1, 0x2F472FB8, 0xDDDFDD06, 0x23342339, 0xCC35CC62, 0xF16AF1C4,
- 0xC1CFC112, 0x85DC85EB, 0x8F228F9E, 0x71C971A1, 0x90C090F0, 0xAA9BAA53,
- 0x018901F1, 0x8BD48BE1, 0x4EED4E8C, 0x8EAB8E6F, 0xAB12ABA2, 0x6FA26F3E,
- 0xE60DE654, 0xDB52DBF2, 0x92BB927B, 0xB702B7B6, 0x692F69CA, 0x39A939D9,
- 0xD3D7D30C, 0xA761A723, 0xA21EA2AD, 0xC3B4C399, 0x6C506C44, 0x07040705,
- 0x04F6047F, 0x27C22746, 0xAC16ACA7, 0xD025D076, 0x50865013, 0xDC56DCF7,
- 0x8455841A, 0xE109E151, 0x7ABE7A25, 0x139113EF},
-
- {0xD939A9D9, 0x90176790, 0x719CB371, 0xD2A6E8D2, 0x05070405, 0x9852FD98,
- 0x6580A365, 0xDFE476DF, 0x08459A08, 0x024B9202, 0xA0E080A0, 0x665A7866,
- 0xDDAFE4DD, 0xB06ADDB0, 0xBF63D1BF, 0x362A3836, 0x54E60D54, 0x4320C643,
- 0x62CC3562, 0xBEF298BE, 0x1E12181E, 0x24EBF724, 0xD7A1ECD7, 0x77416C77,
- 0xBD2843BD, 0x32BC7532, 0xD47B37D4, 0x9B88269B, 0x700DFA70, 0xF94413F9,
- 0xB1FB94B1, 0x5A7E485A, 0x7A03F27A, 0xE48CD0E4, 0x47B68B47, 0x3C24303C,
- 0xA5E784A5, 0x416B5441, 0x06DDDF06, 0xC56023C5, 0x45FD1945, 0xA33A5BA3,
- 0x68C23D68, 0x158D5915, 0x21ECF321, 0x3166AE31, 0x3E6FA23E, 0x16578216,
- 0x95106395, 0x5BEF015B, 0x4DB8834D, 0x91862E91, 0xB56DD9B5, 0x1F83511F,
- 0x53AA9B53, 0x635D7C63, 0x3B68A63B, 0x3FFEEB3F, 0xD630A5D6, 0x257ABE25,
- 0xA7AC16A7, 0x0F090C0F, 0x35F0E335, 0x23A76123, 0xF090C0F0, 0xAFE98CAF,
- 0x809D3A80, 0x925CF592, 0x810C7381, 0x27312C27, 0x76D02576, 0xE7560BE7,
- 0x7B92BB7B, 0xE9CE4EE9, 0xF10189F1, 0x9F1E6B9F, 0xA93453A9, 0xC4F16AC4,
- 0x99C3B499, 0x975BF197, 0x8347E183, 0x6B18E66B, 0xC822BDC8, 0x0E98450E,
- 0x6E1FE26E, 0xC9B3F4C9, 0x2F74B62F, 0xCBF866CB, 0xFF99CCFF, 0xEA1495EA,
- 0xED5803ED, 0xF7DC56F7, 0xE18BD4E1, 0x1B151C1B, 0xADA21EAD, 0x0CD3D70C,
- 0x2BE2FB2B, 0x1DC8C31D, 0x195E8E19, 0xC22CB5C2, 0x8949E989, 0x12C1CF12,
- 0x7E95BF7E, 0x207DBA20, 0x6411EA64, 0x840B7784, 0x6DC5396D, 0x6A89AF6A,
- 0xD17C33D1, 0xA171C9A1, 0xCEFF62CE, 0x37BB7137, 0xFB0F81FB, 0x3DB5793D,
- 0x51E10951, 0xDC3EADDC, 0x2D3F242D, 0xA476CDA4, 0x9D55F99D, 0xEE82D8EE,
- 0x8640E586, 0xAE78C5AE, 0xCD25B9CD, 0x04964D04, 0x55774455, 0x0A0E080A,
- 0x13508613, 0x30F7E730, 0xD337A1D3, 0x40FA1D40, 0x3461AA34, 0x8C4EED8C,
- 0xB3B006B3, 0x6C54706C, 0x2A73B22A, 0x523BD252, 0x0B9F410B, 0x8B027B8B,
- 0x88D8A088, 0x4FF3114F, 0x67CB3167, 0x4627C246, 0xC06727C0, 0xB4FC90B4,
- 0x28382028, 0x7F04F67F, 0x78486078, 0x2EE5FF2E, 0x074C9607, 0x4B655C4B,
- 0xC72BB1C7, 0x6F8EAB6F, 0x0D429E0D, 0xBBF59CBB, 0xF2DB52F2, 0xF34A1BF3,
- 0xA63D5FA6, 0x59A49359, 0xBCB90ABC, 0x3AF9EF3A, 0xEF1391EF, 0xFE0885FE,
- 0x01914901, 0x6116EE61, 0x7CDE2D7C, 0xB2214FB2, 0x42B18F42, 0xDB723BDB,
- 0xB82F47B8, 0x48BF8748, 0x2CAE6D2C, 0xE3C046E3, 0x573CD657, 0x859A3E85,
- 0x29A96929, 0x7D4F647D, 0x94812A94, 0x492ECE49, 0x17C6CB17, 0xCA692FCA,
- 0xC3BDFCC3, 0x5CA3975C, 0x5EE8055E, 0xD0ED7AD0, 0x87D1AC87, 0x8E057F8E,
- 0xBA64D5BA, 0xA8A51AA8, 0xB7264BB7, 0xB9BE0EB9, 0x6087A760, 0xF8D55AF8,
- 0x22362822, 0x111B1411, 0xDE753FDE, 0x79D92979, 0xAAEE88AA, 0x332D3C33,
- 0x5F794C5F, 0xB6B702B6, 0x96CAB896, 0x5835DA58, 0x9CC4B09C, 0xFC4317FC,
- 0x1A84551A, 0xF64D1FF6, 0x1C598A1C, 0x38B27D38, 0xAC3357AC, 0x18CFC718,
- 0xF4068DF4, 0x69537469, 0x749BB774, 0xF597C4F5, 0x56AD9F56, 0xDAE372DA,
- 0xD5EA7ED5, 0x4AF4154A, 0x9E8F229E, 0xA2AB12A2, 0x4E62584E, 0xE85F07E8,
- 0xE51D99E5, 0x39233439, 0xC1F66EC1, 0x446C5044, 0x5D32DE5D, 0x72466872,
- 0x26A06526, 0x93CDBC93, 0x03DADB03, 0xC6BAF8C6, 0xFA9EC8FA, 0x82D6A882,
- 0xCF6E2BCF, 0x50704050, 0xEB85DCEB, 0x750AFE75, 0x8A93328A, 0x8DDFA48D,
- 0x4C29CA4C, 0x141C1014, 0x73D72173, 0xCCB4F0CC, 0x09D4D309, 0x108A5D10,
- 0xE2510FE2, 0x00000000, 0x9A196F9A, 0xE01A9DE0, 0x8F94368F, 0xE6C742E6,
- 0xECC94AEC, 0xFDD25EFD, 0xAB7FC1AB, 0xD8A8E0D8}
-};
-\f
-/* The exp_to_poly and poly_to_exp tables are used to perform efficient
- * operations in GF(2^8) represented as GF(2)[x]/w(x) where
- * w(x)=x^8+x^6+x^3+x^2+1. We care about doing that because it's part of the
- * definition of the RS matrix in the key schedule. Elements of that field
- * are polynomials of degree not greater than 7 and all coefficients 0 or 1,
- * which can be represented naturally by bytes (just substitute x=2). In that
- * form, GF(2^8) addition is the same as bitwise XOR, but GF(2^8)
- * multiplication is inefficient without hardware support. To multiply
- * faster, I make use of the fact x is a generator for the nonzero elements,
- * so that every element p of GF(2)[x]/w(x) is either 0 or equal to (x)^n for
- * some n in 0..254. Note that that caret is exponentiation in GF(2^8),
- * *not* polynomial notation. So if I want to compute pq where p and q are
- * in GF(2^8), I can just say:
- * 1. if p=0 or q=0 then pq=0
- * 2. otherwise, find m and n such that p=x^m and q=x^n
- * 3. pq=(x^m)(x^n)=x^(m+n), so add m and n and find pq
- * The translations in steps 2 and 3 are looked up in the tables
- * poly_to_exp (for step 2) and exp_to_poly (for step 3). To see this
- * in action, look at the CALC_S macro. As additional wrinkles, note that
- * one of my operands is always a constant, so the poly_to_exp lookup on it
- * is done in advance; I included the original values in the comments so
- * readers can have some chance of recognizing that this *is* the RS matrix
- * from the Twofish paper. I've only included the table entries I actually
- * need; I never do a lookup on a variable input of zero and the biggest
- * exponents I'll ever see are 254 (variable) and 237 (constant), so they'll
- * never sum to more than 491. I'm repeating part of the exp_to_poly table
- * so that I don't have to do mod-255 reduction in the exponent arithmetic.
- * Since I know my constant operands are never zero, I only have to worry
- * about zero values in the variable operand, and I do it with a simple
- * conditional branch. I know conditionals are expensive, but I couldn't
- * see a non-horrible way of avoiding them, and I did manage to group the
- * statements so that each if covers four group multiplications. */
-
-static const byte poly_to_exp[255] = {
- 0x00, 0x01, 0x17, 0x02, 0x2E, 0x18, 0x53, 0x03, 0x6A, 0x2F, 0x93, 0x19,
- 0x34, 0x54, 0x45, 0x04, 0x5C, 0x6B, 0xB6, 0x30, 0xA6, 0x94, 0x4B, 0x1A,
- 0x8C, 0x35, 0x81, 0x55, 0xAA, 0x46, 0x0D, 0x05, 0x24, 0x5D, 0x87, 0x6C,
- 0x9B, 0xB7, 0xC1, 0x31, 0x2B, 0xA7, 0xA3, 0x95, 0x98, 0x4C, 0xCA, 0x1B,
- 0xE6, 0x8D, 0x73, 0x36, 0xCD, 0x82, 0x12, 0x56, 0x62, 0xAB, 0xF0, 0x47,
- 0x4F, 0x0E, 0xBD, 0x06, 0xD4, 0x25, 0xD2, 0x5E, 0x27, 0x88, 0x66, 0x6D,
- 0xD6, 0x9C, 0x79, 0xB8, 0x08, 0xC2, 0xDF, 0x32, 0x68, 0x2C, 0xFD, 0xA8,
- 0x8A, 0xA4, 0x5A, 0x96, 0x29, 0x99, 0x22, 0x4D, 0x60, 0xCB, 0xE4, 0x1C,
- 0x7B, 0xE7, 0x3B, 0x8E, 0x9E, 0x74, 0xF4, 0x37, 0xD8, 0xCE, 0xF9, 0x83,
- 0x6F, 0x13, 0xB2, 0x57, 0xE1, 0x63, 0xDC, 0xAC, 0xC4, 0xF1, 0xAF, 0x48,
- 0x0A, 0x50, 0x42, 0x0F, 0xBA, 0xBE, 0xC7, 0x07, 0xDE, 0xD5, 0x78, 0x26,
- 0x65, 0xD3, 0xD1, 0x5F, 0xE3, 0x28, 0x21, 0x89, 0x59, 0x67, 0xFC, 0x6E,
- 0xB1, 0xD7, 0xF8, 0x9D, 0xF3, 0x7A, 0x3A, 0xB9, 0xC6, 0x09, 0x41, 0xC3,
- 0xAE, 0xE0, 0xDB, 0x33, 0x44, 0x69, 0x92, 0x2D, 0x52, 0xFE, 0x16, 0xA9,
- 0x0C, 0x8B, 0x80, 0xA5, 0x4A, 0x5B, 0xB5, 0x97, 0xC9, 0x2A, 0xA2, 0x9A,
- 0xC0, 0x23, 0x86, 0x4E, 0xBC, 0x61, 0xEF, 0xCC, 0x11, 0xE5, 0x72, 0x1D,
- 0x3D, 0x7C, 0xEB, 0xE8, 0xE9, 0x3C, 0xEA, 0x8F, 0x7D, 0x9F, 0xEC, 0x75,
- 0x1E, 0xF5, 0x3E, 0x38, 0xF6, 0xD9, 0x3F, 0xCF, 0x76, 0xFA, 0x1F, 0x84,
- 0xA0, 0x70, 0xED, 0x14, 0x90, 0xB3, 0x7E, 0x58, 0xFB, 0xE2, 0x20, 0x64,
- 0xD0, 0xDD, 0x77, 0xAD, 0xDA, 0xC5, 0x40, 0xF2, 0x39, 0xB0, 0xF7, 0x49,
- 0xB4, 0x0B, 0x7F, 0x51, 0x15, 0x43, 0x91, 0x10, 0x71, 0xBB, 0xEE, 0xBF,
- 0x85, 0xC8, 0xA1
-};
-
-static const byte exp_to_poly[492] = {
- 0x01, 0x02, 0x04, 0x08, 0x10, 0x20, 0x40, 0x80, 0x4D, 0x9A, 0x79, 0xF2,
- 0xA9, 0x1F, 0x3E, 0x7C, 0xF8, 0xBD, 0x37, 0x6E, 0xDC, 0xF5, 0xA7, 0x03,
- 0x06, 0x0C, 0x18, 0x30, 0x60, 0xC0, 0xCD, 0xD7, 0xE3, 0x8B, 0x5B, 0xB6,
- 0x21, 0x42, 0x84, 0x45, 0x8A, 0x59, 0xB2, 0x29, 0x52, 0xA4, 0x05, 0x0A,
- 0x14, 0x28, 0x50, 0xA0, 0x0D, 0x1A, 0x34, 0x68, 0xD0, 0xED, 0x97, 0x63,
- 0xC6, 0xC1, 0xCF, 0xD3, 0xEB, 0x9B, 0x7B, 0xF6, 0xA1, 0x0F, 0x1E, 0x3C,
- 0x78, 0xF0, 0xAD, 0x17, 0x2E, 0x5C, 0xB8, 0x3D, 0x7A, 0xF4, 0xA5, 0x07,
- 0x0E, 0x1C, 0x38, 0x70, 0xE0, 0x8D, 0x57, 0xAE, 0x11, 0x22, 0x44, 0x88,
- 0x5D, 0xBA, 0x39, 0x72, 0xE4, 0x85, 0x47, 0x8E, 0x51, 0xA2, 0x09, 0x12,
- 0x24, 0x48, 0x90, 0x6D, 0xDA, 0xF9, 0xBF, 0x33, 0x66, 0xCC, 0xD5, 0xE7,
- 0x83, 0x4B, 0x96, 0x61, 0xC2, 0xC9, 0xDF, 0xF3, 0xAB, 0x1B, 0x36, 0x6C,
- 0xD8, 0xFD, 0xB7, 0x23, 0x46, 0x8C, 0x55, 0xAA, 0x19, 0x32, 0x64, 0xC8,
- 0xDD, 0xF7, 0xA3, 0x0B, 0x16, 0x2C, 0x58, 0xB0, 0x2D, 0x5A, 0xB4, 0x25,
- 0x4A, 0x94, 0x65, 0xCA, 0xD9, 0xFF, 0xB3, 0x2B, 0x56, 0xAC, 0x15, 0x2A,
- 0x54, 0xA8, 0x1D, 0x3A, 0x74, 0xE8, 0x9D, 0x77, 0xEE, 0x91, 0x6F, 0xDE,
- 0xF1, 0xAF, 0x13, 0x26, 0x4C, 0x98, 0x7D, 0xFA, 0xB9, 0x3F, 0x7E, 0xFC,
- 0xB5, 0x27, 0x4E, 0x9C, 0x75, 0xEA, 0x99, 0x7F, 0xFE, 0xB1, 0x2F, 0x5E,
- 0xBC, 0x35, 0x6A, 0xD4, 0xE5, 0x87, 0x43, 0x86, 0x41, 0x82, 0x49, 0x92,
- 0x69, 0xD2, 0xE9, 0x9F, 0x73, 0xE6, 0x81, 0x4F, 0x9E, 0x71, 0xE2, 0x89,
- 0x5F, 0xBE, 0x31, 0x62, 0xC4, 0xC5, 0xC7, 0xC3, 0xCB, 0xDB, 0xFB, 0xBB,
- 0x3B, 0x76, 0xEC, 0x95, 0x67, 0xCE, 0xD1, 0xEF, 0x93, 0x6B, 0xD6, 0xE1,
- 0x8F, 0x53, 0xA6, 0x01, 0x02, 0x04, 0x08, 0x10, 0x20, 0x40, 0x80, 0x4D,
- 0x9A, 0x79, 0xF2, 0xA9, 0x1F, 0x3E, 0x7C, 0xF8, 0xBD, 0x37, 0x6E, 0xDC,
- 0xF5, 0xA7, 0x03, 0x06, 0x0C, 0x18, 0x30, 0x60, 0xC0, 0xCD, 0xD7, 0xE3,
- 0x8B, 0x5B, 0xB6, 0x21, 0x42, 0x84, 0x45, 0x8A, 0x59, 0xB2, 0x29, 0x52,
- 0xA4, 0x05, 0x0A, 0x14, 0x28, 0x50, 0xA0, 0x0D, 0x1A, 0x34, 0x68, 0xD0,
- 0xED, 0x97, 0x63, 0xC6, 0xC1, 0xCF, 0xD3, 0xEB, 0x9B, 0x7B, 0xF6, 0xA1,
- 0x0F, 0x1E, 0x3C, 0x78, 0xF0, 0xAD, 0x17, 0x2E, 0x5C, 0xB8, 0x3D, 0x7A,
- 0xF4, 0xA5, 0x07, 0x0E, 0x1C, 0x38, 0x70, 0xE0, 0x8D, 0x57, 0xAE, 0x11,
- 0x22, 0x44, 0x88, 0x5D, 0xBA, 0x39, 0x72, 0xE4, 0x85, 0x47, 0x8E, 0x51,
- 0xA2, 0x09, 0x12, 0x24, 0x48, 0x90, 0x6D, 0xDA, 0xF9, 0xBF, 0x33, 0x66,
- 0xCC, 0xD5, 0xE7, 0x83, 0x4B, 0x96, 0x61, 0xC2, 0xC9, 0xDF, 0xF3, 0xAB,
- 0x1B, 0x36, 0x6C, 0xD8, 0xFD, 0xB7, 0x23, 0x46, 0x8C, 0x55, 0xAA, 0x19,
- 0x32, 0x64, 0xC8, 0xDD, 0xF7, 0xA3, 0x0B, 0x16, 0x2C, 0x58, 0xB0, 0x2D,
- 0x5A, 0xB4, 0x25, 0x4A, 0x94, 0x65, 0xCA, 0xD9, 0xFF, 0xB3, 0x2B, 0x56,
- 0xAC, 0x15, 0x2A, 0x54, 0xA8, 0x1D, 0x3A, 0x74, 0xE8, 0x9D, 0x77, 0xEE,
- 0x91, 0x6F, 0xDE, 0xF1, 0xAF, 0x13, 0x26, 0x4C, 0x98, 0x7D, 0xFA, 0xB9,
- 0x3F, 0x7E, 0xFC, 0xB5, 0x27, 0x4E, 0x9C, 0x75, 0xEA, 0x99, 0x7F, 0xFE,
- 0xB1, 0x2F, 0x5E, 0xBC, 0x35, 0x6A, 0xD4, 0xE5, 0x87, 0x43, 0x86, 0x41,
- 0x82, 0x49, 0x92, 0x69, 0xD2, 0xE9, 0x9F, 0x73, 0xE6, 0x81, 0x4F, 0x9E,
- 0x71, 0xE2, 0x89, 0x5F, 0xBE, 0x31, 0x62, 0xC4, 0xC5, 0xC7, 0xC3, 0xCB
-};
-\f
-
-/* The table constants are indices of
- * S-box entries, preprocessed through q0 and q1. */
-static byte calc_sb_tbl[512] = {
- 0xA9, 0x75, 0x67, 0xF3, 0xB3, 0xC6, 0xE8, 0xF4,
- 0x04, 0xDB, 0xFD, 0x7B, 0xA3, 0xFB, 0x76, 0xC8,
- 0x9A, 0x4A, 0x92, 0xD3, 0x80, 0xE6, 0x78, 0x6B,
- 0xE4, 0x45, 0xDD, 0x7D, 0xD1, 0xE8, 0x38, 0x4B,
- 0x0D, 0xD6, 0xC6, 0x32, 0x35, 0xD8, 0x98, 0xFD,
- 0x18, 0x37, 0xF7, 0x71, 0xEC, 0xF1, 0x6C, 0xE1,
- 0x43, 0x30, 0x75, 0x0F, 0x37, 0xF8, 0x26, 0x1B,
- 0xFA, 0x87, 0x13, 0xFA, 0x94, 0x06, 0x48, 0x3F,
- 0xF2, 0x5E, 0xD0, 0xBA, 0x8B, 0xAE, 0x30, 0x5B,
- 0x84, 0x8A, 0x54, 0x00, 0xDF, 0xBC, 0x23, 0x9D,
- 0x19, 0x6D, 0x5B, 0xC1, 0x3D, 0xB1, 0x59, 0x0E,
- 0xF3, 0x80, 0xAE, 0x5D, 0xA2, 0xD2, 0x82, 0xD5,
- 0x63, 0xA0, 0x01, 0x84, 0x83, 0x07, 0x2E, 0x14,
- 0xD9, 0xB5, 0x51, 0x90, 0x9B, 0x2C, 0x7C, 0xA3,
- 0xA6, 0xB2, 0xEB, 0x73, 0xA5, 0x4C, 0xBE, 0x54,
- 0x16, 0x92, 0x0C, 0x74, 0xE3, 0x36, 0x61, 0x51,
- 0xC0, 0x38, 0x8C, 0xB0, 0x3A, 0xBD, 0xF5, 0x5A,
- 0x73, 0xFC, 0x2C, 0x60, 0x25, 0x62, 0x0B, 0x96,
- 0xBB, 0x6C, 0x4E, 0x42, 0x89, 0xF7, 0x6B, 0x10,
- 0x53, 0x7C, 0x6A, 0x28, 0xB4, 0x27, 0xF1, 0x8C,
- 0xE1, 0x13, 0xE6, 0x95, 0xBD, 0x9C, 0x45, 0xC7,
- 0xE2, 0x24, 0xF4, 0x46, 0xB6, 0x3B, 0x66, 0x70,
- 0xCC, 0xCA, 0x95, 0xE3, 0x03, 0x85, 0x56, 0xCB,
- 0xD4, 0x11, 0x1C, 0xD0, 0x1E, 0x93, 0xD7, 0xB8,
- 0xFB, 0xA6, 0xC3, 0x83, 0x8E, 0x20, 0xB5, 0xFF,
- 0xE9, 0x9F, 0xCF, 0x77, 0xBF, 0xC3, 0xBA, 0xCC,
- 0xEA, 0x03, 0x77, 0x6F, 0x39, 0x08, 0xAF, 0xBF,
- 0x33, 0x40, 0xC9, 0xE7, 0x62, 0x2B, 0x71, 0xE2,
- 0x81, 0x79, 0x79, 0x0C, 0x09, 0xAA, 0xAD, 0x82,
- 0x24, 0x41, 0xCD, 0x3A, 0xF9, 0xEA, 0xD8, 0xB9,
- 0xE5, 0xE4, 0xC5, 0x9A, 0xB9, 0xA4, 0x4D, 0x97,
- 0x44, 0x7E, 0x08, 0xDA, 0x86, 0x7A, 0xE7, 0x17,
- 0xA1, 0x66, 0x1D, 0x94, 0xAA, 0xA1, 0xED, 0x1D,
- 0x06, 0x3D, 0x70, 0xF0, 0xB2, 0xDE, 0xD2, 0xB3,
- 0x41, 0x0B, 0x7B, 0x72, 0xA0, 0xA7, 0x11, 0x1C,
- 0x31, 0xEF, 0xC2, 0xD1, 0x27, 0x53, 0x90, 0x3E,
- 0x20, 0x8F, 0xF6, 0x33, 0x60, 0x26, 0xFF, 0x5F,
- 0x96, 0xEC, 0x5C, 0x76, 0xB1, 0x2A, 0xAB, 0x49,
- 0x9E, 0x81, 0x9C, 0x88, 0x52, 0xEE, 0x1B, 0x21,
- 0x5F, 0xC4, 0x93, 0x1A, 0x0A, 0xEB, 0xEF, 0xD9,
- 0x91, 0xC5, 0x85, 0x39, 0x49, 0x99, 0xEE, 0xCD,
- 0x2D, 0xAD, 0x4F, 0x31, 0x8F, 0x8B, 0x3B, 0x01,
- 0x47, 0x18, 0x87, 0x23, 0x6D, 0xDD, 0x46, 0x1F,
- 0xD6, 0x4E, 0x3E, 0x2D, 0x69, 0xF9, 0x64, 0x48,
- 0x2A, 0x4F, 0xCE, 0xF2, 0xCB, 0x65, 0x2F, 0x8E,
- 0xFC, 0x78, 0x97, 0x5C, 0x05, 0x58, 0x7A, 0x19,
- 0xAC, 0x8D, 0x7F, 0xE5, 0xD5, 0x98, 0x1A, 0x57,
- 0x4B, 0x67, 0x0E, 0x7F, 0xA7, 0x05, 0x5A, 0x64,
- 0x28, 0xAF, 0x14, 0x63, 0x3F, 0xB6, 0x29, 0xFE,
- 0x88, 0xF5, 0x3C, 0xB7, 0x4C, 0x3C, 0x02, 0xA5,
- 0xB8, 0xCE, 0xDA, 0xE9, 0xB0, 0x68, 0x17, 0x44,
- 0x55, 0xE0, 0x1F, 0x4D, 0x8A, 0x43, 0x7D, 0x69,
- 0x57, 0x29, 0xC7, 0x2E, 0x8D, 0xAC, 0x74, 0x15,
- 0xB7, 0x59, 0xC4, 0xA8, 0x9F, 0x0A, 0x72, 0x9E,
- 0x7E, 0x6E, 0x15, 0x47, 0x22, 0xDF, 0x12, 0x34,
- 0x58, 0x35, 0x07, 0x6A, 0x99, 0xCF, 0x34, 0xDC,
- 0x6E, 0x22, 0x50, 0xC9, 0xDE, 0xC0, 0x68, 0x9B,
- 0x65, 0x89, 0xBC, 0xD4, 0xDB, 0xED, 0xF8, 0xAB,
- 0xC8, 0x12, 0xA8, 0xA2, 0x2B, 0x0D, 0x40, 0x52,
- 0xDC, 0xBB, 0xFE, 0x02, 0x32, 0x2F, 0xA4, 0xA9,
- 0xCA, 0xD7, 0x10, 0x61, 0x21, 0x1E, 0xF0, 0xB4,
- 0xD3, 0x50, 0x5D, 0x04, 0x0F, 0xF6, 0x00, 0xC2,
- 0x6F, 0x16, 0x9D, 0x25, 0x36, 0x86, 0x42, 0x56,
- 0x4A, 0x55, 0x5E, 0x09, 0xC1, 0xBE, 0xE0, 0x91
-};
-/* Macro to perform one column of the RS matrix multiplication. The
- * parameters a, b, c, and d are the four bytes of output; i is the index
- * of the key bytes, and w, x, y, and z, are the column of constants from
- * the RS matrix, preprocessed through the poly_to_exp table. */
-
-#define CALC_S(a, b, c, d, i, w, x, y, z) \
- if (key[i]) { \
- tmp = poly_to_exp[key[i] - 1]; \
- (a) ^= exp_to_poly[tmp + (w)]; \
- (b) ^= exp_to_poly[tmp + (x)]; \
- (c) ^= exp_to_poly[tmp + (y)]; \
- (d) ^= exp_to_poly[tmp + (z)]; \
- }
-
-/* Macros to calculate the key-dependent S-boxes for a 128-bit key using
- * the S vector from CALC_S. CALC_SB_2 computes a single entry in all
- * four S-boxes, where i is the index of the entry to compute, and a and b
- * are the index numbers preprocessed through the q0 and q1 tables
- * respectively. CALC_SB is simply a convenience to make the code shorter;
- * it calls CALC_SB_2 four times with consecutive indices from i to i+3,
- * using the remaining parameters two by two. */
-
-#define CALC_SB_2(i, a, b) \
- ctx->s[0][i] = mds[0][q0[(a) ^ sa] ^ se]; \
- ctx->s[1][i] = mds[1][q0[(b) ^ sb] ^ sf]; \
- ctx->s[2][i] = mds[2][q1[(a) ^ sc] ^ sg]; \
- ctx->s[3][i] = mds[3][q1[(b) ^ sd] ^ sh]
-
-#define CALC_SB(i, a, b, c, d, e, f, g, h) \
- CALC_SB_2 (i, a, b); CALC_SB_2 ((i)+1, c, d); \
- CALC_SB_2 ((i)+2, e, f); CALC_SB_2 ((i)+3, g, h)
-
-/* Macros exactly like CALC_SB and CALC_SB_2, but for 256-bit keys. */
-
-#define CALC_SB256_2(i, a, b) \
- ctx->s[0][i] = mds[0][q0[q0[q1[(b) ^ sa] ^ se] ^ si] ^ sm]; \
- ctx->s[1][i] = mds[1][q0[q1[q1[(a) ^ sb] ^ sf] ^ sj] ^ sn]; \
- ctx->s[2][i] = mds[2][q1[q0[q0[(a) ^ sc] ^ sg] ^ sk] ^ so]; \
- ctx->s[3][i] = mds[3][q1[q1[q0[(b) ^ sd] ^ sh] ^ sl] ^ sp];
-
-#define CALC_SB256(i, a, b, c, d, e, f, g, h) \
- CALC_SB256_2 (i, a, b); CALC_SB256_2 ((i)+1, c, d); \
- CALC_SB256_2 ((i)+2, e, f); CALC_SB256_2 ((i)+3, g, h)
-
-/* Macros to calculate the whitening and round subkeys. CALC_K_2 computes the
- * last two stages of the h() function for a given index (either 2i or 2i+1).
- * a, b, c, and d are the four bytes going into the last two stages. For
- * 128-bit keys, this is the entire h() function and a and c are the index
- * preprocessed through q0 and q1 respectively; for longer keys they are the
- * output of previous stages. j is the index of the first key byte to use.
- * CALC_K computes a pair of subkeys for 128-bit Twofish, by calling CALC_K_2
- * twice, doing the Psuedo-Hadamard Transform, and doing the necessary
- * rotations. Its parameters are: a, the array to write the results into,
- * j, the index of the first output entry, k and l, the preprocessed indices
- * for index 2i, and m and n, the preprocessed indices for index 2i+1.
- * CALC_K256_2 expands CALC_K_2 to handle 256-bit keys, by doing two
- * additional lookup-and-XOR stages. The parameters a and b are the index
- * preprocessed through q0 and q1 respectively; j is the index of the first
- * key byte to use. CALC_K256 is identical to CALC_K but for using the
- * CALC_K256_2 macro instead of CALC_K_2. */
-
-#define CALC_K_2(a, b, c, d, j) \
- mds[0][q0[a ^ key[(j) + 8]] ^ key[j]] \
- ^ mds[1][q0[b ^ key[(j) + 9]] ^ key[(j) + 1]] \
- ^ mds[2][q1[c ^ key[(j) + 10]] ^ key[(j) + 2]] \
- ^ mds[3][q1[d ^ key[(j) + 11]] ^ key[(j) + 3]]
-
-#define CALC_K(a, j, k, l, m, n) \
- x = CALC_K_2 (k, l, k, l, 0); \
- y = CALC_K_2 (m, n, m, n, 4); \
- y = (y << 8) + (y >> 24); \
- x += y; y += x; ctx->a[j] = x; \
- ctx->a[(j) + 1] = (y << 9) + (y >> 23)
-
-#define CALC_K256_2(a, b, j) \
- CALC_K_2 (q0[q1[b ^ key[(j) + 24]] ^ key[(j) + 16]], \
- q1[q1[a ^ key[(j) + 25]] ^ key[(j) + 17]], \
- q0[q0[a ^ key[(j) + 26]] ^ key[(j) + 18]], \
- q1[q0[b ^ key[(j) + 27]] ^ key[(j) + 19]], j)
-
-#define CALC_K256(a, j, k, l, m, n) \
- x = CALC_K256_2 (k, l, 0); \
- y = CALC_K256_2 (m, n, 4); \
- y = (y << 8) + (y >> 24); \
- x += y; y += x; ctx->a[j] = x; \
- ctx->a[(j) + 1] = (y << 9) + (y >> 23)
-\f
-
-
-/* Perform the key setup. Note that this works only with 128- and 256-bit
- * keys, despite the API that looks like it might support other sizes. */
-
-int
-do_twofish_setkey (TWOFISH_context *ctx, const byte *key, const unsigned keylen)
-{
- int i, j, k;
-
- /* Temporaries for CALC_K. */
- u32 x, y;
-
- /* The S vector used to key the S-boxes, split up into individual bytes.
- * 128-bit keys use only sa through sh; 256-bit use all of them. */
- byte sa = 0, sb = 0, sc = 0, sd = 0, se = 0, sf = 0, sg = 0, sh = 0;
- byte si = 0, sj = 0, sk = 0, sl = 0, sm = 0, sn = 0, so = 0, sp = 0;
-
- /* Temporary for CALC_S. */
- byte tmp;
-
- /* Flags for self-test. */
- static int initialized = 0;
- static const char *selftest_failed=0;
-
- /* Check key length. */
- if( ( ( keylen - 16 ) | 16 ) != 16 )
- return -1;
-
- /* Do self-test if necessary. */
- if (!initialized)
- {
- initialized = 1;
- selftest_failed = selftest ();
- if( selftest_failed )
- log_error("%s\n", selftest_failed );
- }
- if( selftest_failed )
- return -1;
-
- /* Compute the first two words of the S vector. The magic numbers are
- * the entries of the RS matrix, preprocessed through poly_to_exp. The
- * numbers in the comments are the original (polynomial form) matrix
- * entries. */
- CALC_S (sa, sb, sc, sd, 0, 0x00, 0x2D, 0x01, 0x2D); /* 01 A4 02 A4 */
- CALC_S (sa, sb, sc, sd, 1, 0x2D, 0xA4, 0x44, 0x8A); /* A4 56 A1 55 */
- CALC_S (sa, sb, sc, sd, 2, 0x8A, 0xD5, 0xBF, 0xD1); /* 55 82 FC 87 */
- CALC_S (sa, sb, sc, sd, 3, 0xD1, 0x7F, 0x3D, 0x99); /* 87 F3 C1 5A */
- CALC_S (sa, sb, sc, sd, 4, 0x99, 0x46, 0x66, 0x96); /* 5A 1E 47 58 */
- CALC_S (sa, sb, sc, sd, 5, 0x96, 0x3C, 0x5B, 0xED); /* 58 C6 AE DB */
- CALC_S (sa, sb, sc, sd, 6, 0xED, 0x37, 0x4F, 0xE0); /* DB 68 3D 9E */
- CALC_S (sa, sb, sc, sd, 7, 0xE0, 0xD0, 0x8C, 0x17); /* 9E E5 19 03 */
- CALC_S (se, sf, sg, sh, 8, 0x00, 0x2D, 0x01, 0x2D); /* 01 A4 02 A4 */
- CALC_S (se, sf, sg, sh, 9, 0x2D, 0xA4, 0x44, 0x8A); /* A4 56 A1 55 */
- CALC_S (se, sf, sg, sh, 10, 0x8A, 0xD5, 0xBF, 0xD1); /* 55 82 FC 87 */
- CALC_S (se, sf, sg, sh, 11, 0xD1, 0x7F, 0x3D, 0x99); /* 87 F3 C1 5A */
- CALC_S (se, sf, sg, sh, 12, 0x99, 0x46, 0x66, 0x96); /* 5A 1E 47 58 */
- CALC_S (se, sf, sg, sh, 13, 0x96, 0x3C, 0x5B, 0xED); /* 58 C6 AE DB */
- CALC_S (se, sf, sg, sh, 14, 0xED, 0x37, 0x4F, 0xE0); /* DB 68 3D 9E */
- CALC_S (se, sf, sg, sh, 15, 0xE0, 0xD0, 0x8C, 0x17); /* 9E E5 19 03 */
-
- if (keylen == 32) /* 256-bit key */
- {
- /* Calculate the remaining two words of the S vector */
- CALC_S (si, sj, sk, sl, 16, 0x00, 0x2D, 0x01, 0x2D); /* 01 A4 02 A4 */
- CALC_S (si, sj, sk, sl, 17, 0x2D, 0xA4, 0x44, 0x8A); /* A4 56 A1 55 */
- CALC_S (si, sj, sk, sl, 18, 0x8A, 0xD5, 0xBF, 0xD1); /* 55 82 FC 87 */
- CALC_S (si, sj, sk, sl, 19, 0xD1, 0x7F, 0x3D, 0x99); /* 87 F3 C1 5A */
- CALC_S (si, sj, sk, sl, 20, 0x99, 0x46, 0x66, 0x96); /* 5A 1E 47 58 */
- CALC_S (si, sj, sk, sl, 21, 0x96, 0x3C, 0x5B, 0xED); /* 58 C6 AE DB */
- CALC_S (si, sj, sk, sl, 22, 0xED, 0x37, 0x4F, 0xE0); /* DB 68 3D 9E */
- CALC_S (si, sj, sk, sl, 23, 0xE0, 0xD0, 0x8C, 0x17); /* 9E E5 19 03 */
- CALC_S (sm, sn, so, sp, 24, 0x00, 0x2D, 0x01, 0x2D); /* 01 A4 02 A4 */
- CALC_S (sm, sn, so, sp, 25, 0x2D, 0xA4, 0x44, 0x8A); /* A4 56 A1 55 */
- CALC_S (sm, sn, so, sp, 26, 0x8A, 0xD5, 0xBF, 0xD1); /* 55 82 FC 87 */
- CALC_S (sm, sn, so, sp, 27, 0xD1, 0x7F, 0x3D, 0x99); /* 87 F3 C1 5A */
- CALC_S (sm, sn, so, sp, 28, 0x99, 0x46, 0x66, 0x96); /* 5A 1E 47 58 */
- CALC_S (sm, sn, so, sp, 29, 0x96, 0x3C, 0x5B, 0xED); /* 58 C6 AE DB */
- CALC_S (sm, sn, so, sp, 30, 0xED, 0x37, 0x4F, 0xE0); /* DB 68 3D 9E */
- CALC_S (sm, sn, so, sp, 31, 0xE0, 0xD0, 0x8C, 0x17); /* 9E E5 19 03 */
-
- /* Compute the S-boxes. */
- for(i=j=0,k=1; i < 256; i++, j += 2, k += 2 )
- {
- CALC_SB256_2( i, calc_sb_tbl[j], calc_sb_tbl[k] );
- }
-
- /* Calculate whitening and round subkeys. The constants are
- * indices of subkeys, preprocessed through q0 and q1. */
- CALC_K256 (w, 0, 0xA9, 0x75, 0x67, 0xF3);
- CALC_K256 (w, 2, 0xB3, 0xC6, 0xE8, 0xF4);
- CALC_K256 (w, 4, 0x04, 0xDB, 0xFD, 0x7B);
- CALC_K256 (w, 6, 0xA3, 0xFB, 0x76, 0xC8);
- CALC_K256 (k, 0, 0x9A, 0x4A, 0x92, 0xD3);
- CALC_K256 (k, 2, 0x80, 0xE6, 0x78, 0x6B);
- CALC_K256 (k, 4, 0xE4, 0x45, 0xDD, 0x7D);
- CALC_K256 (k, 6, 0xD1, 0xE8, 0x38, 0x4B);
- CALC_K256 (k, 8, 0x0D, 0xD6, 0xC6, 0x32);
- CALC_K256 (k, 10, 0x35, 0xD8, 0x98, 0xFD);
- CALC_K256 (k, 12, 0x18, 0x37, 0xF7, 0x71);
- CALC_K256 (k, 14, 0xEC, 0xF1, 0x6C, 0xE1);
- CALC_K256 (k, 16, 0x43, 0x30, 0x75, 0x0F);
- CALC_K256 (k, 18, 0x37, 0xF8, 0x26, 0x1B);
- CALC_K256 (k, 20, 0xFA, 0x87, 0x13, 0xFA);
- CALC_K256 (k, 22, 0x94, 0x06, 0x48, 0x3F);
- CALC_K256 (k, 24, 0xF2, 0x5E, 0xD0, 0xBA);
- CALC_K256 (k, 26, 0x8B, 0xAE, 0x30, 0x5B);
- CALC_K256 (k, 28, 0x84, 0x8A, 0x54, 0x00);
- CALC_K256 (k, 30, 0xDF, 0xBC, 0x23, 0x9D);
- }
- else
- {
- /* Compute the S-boxes. */
- for(i=j=0,k=1; i < 256; i++, j += 2, k += 2 )
- {
- CALC_SB_2( i, calc_sb_tbl[j], calc_sb_tbl[k] );
- }
-
- /* Calculate whitening and round subkeys. The constants are
- * indices of subkeys, preprocessed through q0 and q1. */
- CALC_K (w, 0, 0xA9, 0x75, 0x67, 0xF3);
- CALC_K (w, 2, 0xB3, 0xC6, 0xE8, 0xF4);
- CALC_K (w, 4, 0x04, 0xDB, 0xFD, 0x7B);
- CALC_K (w, 6, 0xA3, 0xFB, 0x76, 0xC8);
- CALC_K (k, 0, 0x9A, 0x4A, 0x92, 0xD3);
- CALC_K (k, 2, 0x80, 0xE6, 0x78, 0x6B);
- CALC_K (k, 4, 0xE4, 0x45, 0xDD, 0x7D);
- CALC_K (k, 6, 0xD1, 0xE8, 0x38, 0x4B);
- CALC_K (k, 8, 0x0D, 0xD6, 0xC6, 0x32);
- CALC_K (k, 10, 0x35, 0xD8, 0x98, 0xFD);
- CALC_K (k, 12, 0x18, 0x37, 0xF7, 0x71);
- CALC_K (k, 14, 0xEC, 0xF1, 0x6C, 0xE1);
- CALC_K (k, 16, 0x43, 0x30, 0x75, 0x0F);
- CALC_K (k, 18, 0x37, 0xF8, 0x26, 0x1B);
- CALC_K (k, 20, 0xFA, 0x87, 0x13, 0xFA);
- CALC_K (k, 22, 0x94, 0x06, 0x48, 0x3F);
- CALC_K (k, 24, 0xF2, 0x5E, 0xD0, 0xBA);
- CALC_K (k, 26, 0x8B, 0xAE, 0x30, 0x5B);
- CALC_K (k, 28, 0x84, 0x8A, 0x54, 0x00);
- CALC_K (k, 30, 0xDF, 0xBC, 0x23, 0x9D);
- }
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-#include <stdlib.h>
-
-int factorial(int x) {
- if (x == 0)
- return 1;
-
- return x * factorial(x-1);
-}
-
-int main(int argc, char **argv) {
- int val = 7;
- if(argc>1)
- val = atoi(argv[1]);
- printf("%d\n", factorial(val));
-}
+++ /dev/null
-/*$ -fno-inline $*/
-
-int __attribute__((fastcall)) test(int a, int b, int c) {
- return a+b - c;
-}
-
-int main() {
- return test(4, -4, 0);
-}
+++ /dev/null
-/*
-
- John Walker's Floating Point Benchmark, derived from...
-
- Marinchip Interactive Lens Design System
-
- John Walker December 1980
-
- By John Walker
- http://www.fourmilab.ch/
-
- This program may be used, distributed, and modified freely as
- long as the origin information is preserved.
-
- This is a complete optical design raytracing algorithm,
- stripped of its user interface and recast into portable C. It
- not only determines execution speed on an extremely floating
- point (including trig function) intensive real-world
- application, it checks accuracy on an algorithm that is
- exquisitely sensitive to errors. The performance of this
- program is typically far more sensitive to changes in the
- efficiency of the trigonometric library routines than the
- average floating point program.
-
- The benchmark may be compiled in two modes. If the symbol
- INTRIG is defined, built-in trigonometric and square root
- routines will be used for all calculations. Timings made with
- INTRIG defined reflect the machine's basic floating point
- performance for the arithmetic operators. If INTRIG is not
- defined, the system library <math.h> functions are used.
- Results with INTRIG not defined reflect the system's library
- performance and/or floating point hardware support for trig
- functions and square root. Results with INTRIG defined are a
- good guide to general floating point performance, while
- results with INTRIG undefined indicate the performance of an
- application which is math function intensive.
-
- Special note regarding errors in accuracy: this program has
- generated numbers identical to the last digit it formats and
- checks on the following machines, floating point
- architectures, and languages:
-
- Marinchip 9900 QBASIC IBM 370 double-precision (REAL * 8) format
-
- IBM PC / XT / AT Lattice C IEEE 64 bit, 80 bit temporaries
- High C same, in line 80x87 code
- BASICA "Double precision"
- Quick BASIC IEEE double precision, software routines
-
- Sun 3 C IEEE 64 bit, 80 bit temporaries,
- in-line 68881 code, in-line FPA code.
-
- MicroVAX II C Vax "G" format floating point
-
- Macintosh Plus MPW C SANE floating point, IEEE 64 bit format
- implemented in ROM.
-
- Inaccuracies reported by this program should be taken VERY
- SERIOUSLY INDEED, as the program has been demonstrated to be
- invariant under changes in floating point format, as long as
- the format is a recognised double precision format. If you
- encounter errors, please remember that they are just as likely
- to be in the floating point editing library or the
- trigonometric libraries as in the low level operator code.
-
- The benchmark assumes that results are basically reliable, and
- only tests the last result computed against the reference. If
- you're running on a suspect system you can compile this
- program with ACCURACY defined. This will generate a version
- which executes as an infinite loop, performing the ray trace
- and checking the results on every pass. All incorrect results
- will be reported.
-
- Representative timings are given below. All have been
- normalised as if run for 1000 iterations.
-
- Time in seconds Computer, Compiler, and notes
- Normal INTRIG
-
- 3466.00 4031.00 Commodore 128, 2 Mhz 8510 with software floating
- point. Abacus Software/Data-Becker Super-C 128,
- version 3.00, run in fast (2 Mhz) mode. Note:
- the results generated by this system differed
- from the reference results in the 8th to 10th
- decimal place.
-
- 3290.00 IBM PC/AT 6 Mhz, Microsoft/IBM BASICA version A3.00.
- Run with the "/d" switch, software floating point.
-
- 2131.50 IBM PC/AT 6 Mhz, Lattice C version 2.14, small model.
- This version of Lattice compiles subroutine
- calls which either do software floating point
- or use the 80x87. The machine on which I ran
- this had an 80287, but the results were so bad
- I wonder if it was being used.
-
- 1598.00 Macintosh Plus, MPW C, SANE Software floating point.
-
- 1582.13 Marinchip 9900 2 Mhz, QBASIC compiler with software
- floating point. This was a QBASIC version of the
- program which contained the identical algorithm.
-
- 404.00 IBM PC/AT 6 Mhz, Microsoft QuickBASIC version 2.0.
- Software floating point.
-
- 165.15 IBM PC/AT 6 Mhz, Metaware High C version 1.3, small
- model. This was compiled to call subroutines for
- floating point, and the machine contained an 80287
- which was used by the subroutines.
-
- 143.20 Macintosh II, MPW C, SANE calls. I was unable to
- determine whether SANE was using the 68881 chip or
- not.
-
- 121.80 Sun 3/160 16 Mhz, Sun C. Compiled with -fsoft switch
- which executes floating point in software.
-
- 78.78 110.11 IBM RT PC (Model 6150). IBM AIX 1.0 C compiler
- with -O switch.
-
- 75.2 254.0 Microsoft Quick C 1.0, in-line 8087 instructions,
- compiled with 80286 optimisation on. (Switches
- were -Ol -FPi87-G2 -AS). Small memory model.
-
- 69.50 IBM PC/AT 6Mhz, Borland Turbo BASIC 1.0. Compiled
- in "8087 required" mode to generate in-line
- code for the math coprocessor.
-
- 66.96 IBM PC/AT 6Mhz, Microsoft QuickBASIC 4.0. This
- release of QuickBASIC compiles code for the
- 80287 math coprocessor.
-
- 66.36 206.35 IBM PC/AT 6Mhz, Metaware High C version 1.3, small
- model. This was compiled with in-line code for the
- 80287 math coprocessor. Trig functions still call
- library routines.
-
- 63.07 220.43 IBM PC/AT, 6Mhz, Borland Turbo C, in-line 8087 code,
- small model, word alignment, no stack checking,
- 8086 code mode.
-
- 17.18 Apollo DN-3000, 12 Mhz 68020 with 68881, compiled
- with in-line code for the 68881 coprocessor.
- According to Apollo, the library routines are chosen
- at runtime based on coprocessor presence. Since the
- coprocessor was present, the library is supposed to
- use in-line floating point code.
-
- 15.55 27.56 VAXstation II GPX. Compiled and executed under
- VAX/VMS C.
-
- 15.14 37.93 Macintosh II, Unix system V. Green Hills 68020
- Unix compiler with in-line code for the 68881
- coprocessor (-O -ZI switches).
-
- 12.69 Sun 3/160 16 Mhz, Sun C. Compiled with -fswitch,
- which calls a subroutine to select the fastest
- floating point processor. This was using the 68881.
-
- 11.74 26.73 Compaq Deskpro 386, 16 Mhz 80386 with 16 Mhz 80387.
- Metaware High C version 1.3, compiled with in-line
- for the math coprocessor (but not optimised for the
- 80386/80387). Trig functions still call library
- routines.
-
- 8.43 30.49 Sun 3/160 16 Mhz, Sun C. Compiled with -f68881,
- generating in-line MC68881 instructions. Trig
- functions still call library routines.
-
- 6.29 25.17 Sun 3/260 25 Mhz, Sun C. Compiled with -f68881,
- generating in-line MC68881 instructions. Trig
- functions still call library routines.
-
- 4.57 Sun 3/260 25 Mhz, Sun FORTRAN 77. Compiled with
- -O -f68881, generating in-line MC68881 instructions.
- Trig functions are compiled in-line. This used
- the FORTRAN 77 version of the program, FBFORT77.F.
-
- 4.00 14.20 Sun386i/25 Mhz model 250, Sun C compiler.
-
- 4.00 14.00 Sun386i/25 Mhz model 250, Metaware C.
-
- 3.10 12.00 Compaq 386/387 25 Mhz running SCO Xenix 2.
- Compiled with Metaware HighC 386, optimized
- for 386.
-
- 3.00 12.00 Compaq 386/387 25MHZ optimized for 386/387.
-
- 2.96 5.17 Sun 4/260, Sparc RISC processor. Sun C,
- compiled with the -O2 switch for global
- optimisation.
-
- 2.47 COMPAQ 486/25, secondary cache disabled, High C,
- 486/387, inline f.p., small memory model.
-
- 2.20 3.40 Data General Motorola 88000, 16 Mhz, Gnu C.
-
- 1.56 COMPAQ 486/25, 128K secondary cache, High C, 486/387,
- inline f.p., small memory model.
-
- 0.66 1.50 DEC Pmax, Mips processor.
-
- 0.63 0.91 Sun SparcStation 2, Sun C (SunOS 4.1.1) with
- -O4 optimisation and "/usr/lib/libm.il" inline
- floating point.
-
- 0.60 1.07 Intel 860 RISC processor, 33 Mhz, Greenhills
- C compiler.
-
- 0.40 0.90 Dec 3MAX, MIPS 3000 processor, -O4.
-
- 0.31 0.90 IBM RS/6000, -O.
-
- 0.1129 0.2119 Dell Dimension XPS P133c, Pentium 133 MHz,
- Windows 95, Microsoft Visual C 5.0.
-
- 0.0883 0.2166 Silicon Graphics Indigo², MIPS R4400,
- 175 Mhz, "-O3".
-
- 0.0351 0.0561 Dell Dimension XPS R100, Pentium II 400 MHz,
- Windows 98, Microsoft Visual C 5.0.
-
- 0.0312 0.0542 Sun Ultra 2, UltraSPARC V9, 300 MHz, Solaris
- 2.5.1.
-
- 0.00862 0.01074 Dell Inspiron 9100, Pentium 4, 3.4 GHz, gcc -O3.
-
-*/
-
-#include <stdio.h>
-#include <stdlib.h>
-#include <string.h>
-#ifndef INTRIG
-#include <math.h>
-#endif
-
-#define cot(x) (1.0 / tan(x))
-
-#undef ACCURACY
-
-#define TRUE 1
-#define FALSE 0
-
-#define max_surfaces 10
-
-/* Local variables */
-
-static char tbfr[132];
-
-static short current_surfaces;
-static short paraxial;
-
-static double clear_aperture;
-
-static double aberr_lspher;
-static double aberr_osc;
-static double aberr_lchrom;
-
-static double max_lspher;
-static double max_osc;
-static double max_lchrom;
-
-static double radius_of_curvature;
-static double object_distance;
-static double ray_height;
-static double axis_slope_angle;
-static double from_index;
-static double to_index;
-
-static double spectral_line[9];
-static double s[max_surfaces][5];
-static double od_sa[2][2];
-
-static char outarr[8][80]; /* Computed output of program goes here */
-
-int itercount; /* The iteration counter for the main loop
- in the program is made global so that
- the compiler should not be allowed to
- optimise out the loop over the ray
- tracing code. */
-
-#ifndef ITERATIONS
-#define ITERATIONS 1000
-#endif
-int niter = ITERATIONS; /* Iteration counter */
-
-static char *refarr[] = { /* Reference results. These happen to
- be derived from a run on Microsoft
- Quick BASIC on the IBM PC/AT. */
-
- " Marginal ray 47.09479120920 0.04178472683",
- " Paraxial ray 47.08372160249 0.04177864821",
- "Longitudinal spherical aberration: -0.01106960671",
- " (Maximum permissible): 0.05306749907",
- "Offense against sine condition (coma): 0.00008954761",
- " (Maximum permissible): 0.00250000000",
- "Axial chromatic aberration: 0.00448229032",
- " (Maximum permissible): 0.05306749907"
-};
-
-/* The test case used in this program is the design for a 4 inch
- achromatic telescope objective used as the example in Wyld's
- classic work on ray tracing by hand, given in Amateur Telescope
- Making, Volume 3. */
-
-static double testcase[4][4] = {
- {27.05, 1.5137, 63.6, 0.52},
- {-16.68, 1, 0, 0.138},
- {-16.68, 1.6164, 36.7, 0.38},
- {-78.1, 1, 0, 0}
-};
-
-/* Internal trig functions (used only if INTRIG is defined). These
- standard functions may be enabled to obtain timings that reflect
- the machine's floating point performance rather than the speed of
- its trig function evaluation. */
-
-#ifdef INTRIG
-
-/* The following definitions should keep you from getting intro trouble
- with compilers which don't let you redefine intrinsic functions. */
-
-#define sin I_sin
-#define cos I_cos
-#define tan I_tan
-#define sqrt I_sqrt
-#define atan I_atan
-#define atan2 I_atan2
-#define asin I_asin
-
-#define fabs(x) ((x < 0.0) ? -x : x)
-
-#define pic 3.1415926535897932
-
-/* Commonly used constants */
-
-static double pi = pic,
- twopi =pic * 2.0,
- piover4 = pic / 4.0,
- fouroverpi = 4.0 / pic,
- piover2 = pic / 2.0;
-
-/* Coefficients for ATAN evaluation */
-
-static double atanc[] = {
- 0.0,
- 0.4636476090008061165,
- 0.7853981633974483094,
- 0.98279372324732906714,
- 1.1071487177940905022,
- 1.1902899496825317322,
- 1.2490457723982544262,
- 1.2924966677897852673,
- 1.3258176636680324644
-};
-
-/* aint(x) Return integer part of number. Truncates towards 0 */
-
-double aint(x)
-double x;
-{
- long l;
-
- /* Note that this routine cannot handle the full floating point
- number range. This function should be in the machine-dependent
- floating point library! */
-
- l = x;
- if ((int)(-0.5) != 0 && l < 0 )
- l++;
- x = l;
- return x;
-}
-
-/* sin(x) Return sine, x in radians */
-
-static double sin(x)
-double x;
-{
- int sign;
- double y, r, z;
-
- x = (((sign= (x < 0.0)) != 0) ? -x: x);
-
- if (x > twopi)
- x -= (aint(x / twopi) * twopi);
-
- if (x > pi) {
- x -= pi;
- sign = !sign;
- }
-
- if (x > piover2)
- x = pi - x;
-
- if (x < piover4) {
- y = x * fouroverpi;
- z = y * y;
- r = y * (((((((-0.202253129293E-13 * z + 0.69481520350522E-11) * z -
- 0.17572474176170806E-8) * z + 0.313361688917325348E-6) * z -
- 0.365762041821464001E-4) * z + 0.249039457019271628E-2) * z -
- 0.0807455121882807815) * z + 0.785398163397448310);
- } else {
- y = (piover2 - x) * fouroverpi;
- z = y * y;
- r = ((((((-0.38577620372E-12 * z + 0.11500497024263E-9) * z -
- 0.2461136382637005E-7) * z + 0.359086044588581953E-5) * z -
- 0.325991886926687550E-3) * z + 0.0158543442438154109) * z -
- 0.308425137534042452) * z + 1.0;
- }
- return sign ? -r : r;
-}
-
-/* cos(x) Return cosine, x in radians, by identity */
-
-static double cos(x)
-double x;
-{
- x = (x < 0.0) ? -x : x;
- if (x > twopi) /* Do range reduction here to limit */
- x = x - (aint(x / twopi) * twopi); /* roundoff on add of PI/2 */
- return sin(x + piover2);
-}
-
-/* tan(x) Return tangent, x in radians, by identity */
-
-static double tan(x)
-double x;
-{
- return sin(x) / cos(x);
-}
-
-/* sqrt(x) Return square root. Initial guess, then Newton-
- Raphson refinement */
-
-double sqrt(x)
-double x;
-{
- double c, cl, y;
- int n;
-
- if (x == 0.0)
- return 0.0;
-
- if (x < 0.0) {
- fprintf(stderr,
- "\nGood work! You tried to take the square root of %g",
- x);
- fprintf(stderr,
- "\nunfortunately, that is too complex for me to handle.\n");
- exit(1);
- }
-
- y = (0.154116 + 1.893872 * x) / (1.0 + 1.047988 * x);
-
- c = (y - x / y) / 2.0;
- cl = 0.0;
- for (n = 50; c != cl && n--;) {
- y = y - c;
- cl = c;
- c = (y - x / y) / 2.0;
- }
- return y;
-}
-
-/* atan(x) Return arctangent in radians,
- range -pi/2 to pi/2 */
-
-static double atan(x)
-double x;
-{
- int sign, l, y;
- double a, b, z;
-
- x = (((sign = (x < 0.0)) != 0) ? -x : x);
- l = 0;
-
- if (x >= 4.0) {
- l = -1;
- x = 1.0 / x;
- y = 0;
- goto atl;
- } else {
- if (x < 0.25) {
- y = 0;
- goto atl;
- }
- }
-
- y = aint(x / 0.5);
- z = y * 0.5;
- x = (x - z) / (x * z + 1);
-
-atl:
- z = x * x;
- b = ((((893025.0 * z + 49116375.0) * z + 425675250.0) * z +
- 1277025750.0) * z + 1550674125.0) * z + 654729075.0;
- a = (((13852575.0 * z + 216602100.0) * z + 891080190.0) * z +
- 1332431100.0) * z + 654729075.0;
- a = (a / b) * x + atanc[y];
- if (l)
- a=piover2 - a;
- return sign ? -a : a;
-}
-
-/* atan2(y,x) Return arctangent in radians of y/x,
- range -pi to pi */
-
-static double atan2(y, x)
-double y, x;
-{
- double temp;
-
- if (x == 0.0) {
- if (y == 0.0) /* Special case: atan2(0,0) = 0 */
- return 0.0;
- else if (y > 0)
- return piover2;
- else
- return -piover2;
- }
- temp = atan(y / x);
- if (x < 0.0) {
- if (y >= 0.0)
- temp += pic;
- else
- temp -= pic;
- }
- return temp;
-}
-
-/* asin(x) Return arcsine in radians of x */
-
-static double asin(x)
-double x;
-{
- if (fabs(x)>1.0) {
- fprintf(stderr,
- "\nInverse trig functions lose much of their gloss when");
- fprintf(stderr,
- "\ntheir arguments are greater than 1, such as the");
- fprintf(stderr,
- "\nvalue %g you passed.\n", x);
- exit(1);
- }
- return atan2(x, sqrt(1 - x * x));
-}
-#endif
-
-/* Calculate passage through surface
-
- If the variable PARAXIAL is true, the trace through the
- surface will be done using the paraxial approximations.
- Otherwise, the normal trigonometric trace will be done.
-
- This routine takes the following inputs:
-
- RADIUS_OF_CURVATURE Radius of curvature of surface
- being crossed. If 0, surface is
- plane.
-
- OBJECT_DISTANCE Distance of object focus from
- lens vertex. If 0, incoming
- rays are parallel and
- the following must be specified:
-
- RAY_HEIGHT Height of ray from axis. Only
- relevant if OBJECT.DISTANCE == 0
-
- AXIS_SLOPE_ANGLE Angle incoming ray makes with axis
- at intercept
-
- FROM_INDEX Refractive index of medium being left
-
- TO_INDEX Refractive index of medium being
- entered.
-
- The outputs are the following variables:
-
- OBJECT_DISTANCE Distance from vertex to object focus
- after refraction.
-
- AXIS_SLOPE_ANGLE Angle incoming ray makes with axis
- at intercept after refraction.
-
-*/
-
-static void transit_surface() {
- double iang, /* Incidence angle */
- rang, /* Refraction angle */
- iang_sin, /* Incidence angle sin */
- rang_sin, /* Refraction angle sin */
- old_axis_slope_angle, sagitta;
-
- if (paraxial) {
- if (radius_of_curvature != 0.0) {
- if (object_distance == 0.0) {
- axis_slope_angle = 0.0;
- iang_sin = ray_height / radius_of_curvature;
- } else
- iang_sin = ((object_distance -
- radius_of_curvature) / radius_of_curvature) *
- axis_slope_angle;
-
- rang_sin = (from_index / to_index) *
- iang_sin;
- old_axis_slope_angle = axis_slope_angle;
- axis_slope_angle = axis_slope_angle +
- iang_sin - rang_sin;
- if (object_distance != 0.0)
- ray_height = object_distance * old_axis_slope_angle;
- object_distance = ray_height / axis_slope_angle;
- return;
- }
- object_distance = object_distance * (to_index / from_index);
- axis_slope_angle = axis_slope_angle * (from_index / to_index);
- return;
- }
-
- if (radius_of_curvature != 0.0) {
- if (object_distance == 0.0) {
- axis_slope_angle = 0.0;
- iang_sin = ray_height / radius_of_curvature;
- } else {
- iang_sin = ((object_distance -
- radius_of_curvature) / radius_of_curvature) *
- sin(axis_slope_angle);
- }
- iang = asin(iang_sin);
- rang_sin = (from_index / to_index) *
- iang_sin;
- old_axis_slope_angle = axis_slope_angle;
- axis_slope_angle = axis_slope_angle +
- iang - asin(rang_sin);
- sagitta = sin((old_axis_slope_angle + iang) / 2.0);
- sagitta = 2.0 * radius_of_curvature*sagitta*sagitta;
- object_distance = ((radius_of_curvature * sin(
- old_axis_slope_angle + iang)) *
- cot(axis_slope_angle)) + sagitta;
- return;
- }
-
- rang = -asin((from_index / to_index) *
- sin(axis_slope_angle));
- object_distance = object_distance * ((to_index *
- cos(-rang)) / (from_index *
- cos(axis_slope_angle)));
- axis_slope_angle = -rang;
-}
-
-/* Perform ray trace in specific spectral line */
-
-static void trace_line(line, ray_h)
-int line;
-double ray_h;
-{
- int i;
-
- object_distance = 0.0;
- ray_height = ray_h;
- from_index = 1.0;
-
- for (i = 1; i <= current_surfaces; i++) {
- radius_of_curvature = s[i][1];
- to_index = s[i][2];
- if (to_index > 1.0)
- to_index = to_index + ((spectral_line[4] -
- spectral_line[line]) /
- (spectral_line[3] - spectral_line[6])) * ((s[i][2] - 1.0) /
- s[i][3]);
- transit_surface();
- from_index = to_index;
- if (i < current_surfaces)
- object_distance = object_distance - s[i][4];
- }
-}
-
-/* Initialise when called the first time */
-
-int main(argc, argv)
-int argc;
-char *argv[];
-{
- int i, j, k, errors;
- double od_fline, od_cline;
-#ifdef ACCURACY
- long passes;
-#endif
-
- spectral_line[1] = 7621.0; /* A */
- spectral_line[2] = 6869.955; /* B */
- spectral_line[3] = 6562.816; /* C */
- spectral_line[4] = 5895.944; /* D */
- spectral_line[5] = 5269.557; /* E */
- spectral_line[6] = 4861.344; /* F */
- spectral_line[7] = 4340.477; /* G'*/
- spectral_line[8] = 3968.494; /* H */
-
- /* Process the number of iterations argument, if one is supplied. */
-
- if (argc > 1) {
- niter = atoi(argv[1]);
- if (*argv[1] == '-' || niter < 1) {
- printf("This is John Walker's floating point accuracy and\n");
- printf("performance benchmark program. You call it with\n");
- printf("\nfbench <itercount>\n\n");
- printf("where <itercount> is the number of iterations\n");
- printf("to be executed. Archival timings should be made\n");
- printf("with the iteration count set so that roughly five\n");
- printf("minutes of execution is timed.\n");
- exit(0);
- }
- }
-
- /* Load test case into working array */
-
- clear_aperture = 4.0;
- current_surfaces = 4;
- for (i = 0; i < current_surfaces; i++)
- for (j = 0; j < 4; j++)
- s[i + 1][j + 1] = testcase[i][j];
-
-#ifdef ACCURACY
- printf("Beginning execution of floating point accuracy test...\n");
- passes = 0;
-#else
- printf("Ready to begin John Walker's floating point accuracy\n");
- printf("and performance benchmark. %d iterations will be made.\n\n",
- niter);
-
- printf("\nMeasured run time in seconds should be divided by %.f\n", niter / 1000.0);
- printf("to normalise for reporting results. For archival results,\n");
- printf("adjust iteration count so the benchmark runs about five minutes.\n\n");
-
-#endif
-
- /* Perform ray trace the specified number of times. */
-
-#ifdef ACCURACY
- while (TRUE) {
- passes++;
- if ((passes % 100L) == 0) {
- printf("Pass %ld.\n", passes);
- }
-#else
- for (itercount = 0; itercount < niter; itercount++) {
-#endif
-
- for (paraxial = 0; paraxial <= 1; paraxial++) {
-
- /* Do main trace in D light */
-
- trace_line(4, clear_aperture / 2.0);
- od_sa[paraxial][0] = object_distance;
- od_sa[paraxial][1] = axis_slope_angle;
- }
- paraxial = FALSE;
-
- /* Trace marginal ray in C */
-
- trace_line(3, clear_aperture / 2.0);
- od_cline = object_distance;
-
- /* Trace marginal ray in F */
-
- trace_line(6, clear_aperture / 2.0);
- od_fline = object_distance;
-
- aberr_lspher = od_sa[1][0] - od_sa[0][0];
- aberr_osc = 1.0 - (od_sa[1][0] * od_sa[1][1]) /
- (sin(od_sa[0][1]) * od_sa[0][0]);
- aberr_lchrom = od_fline - od_cline;
- max_lspher = sin(od_sa[0][1]);
-
- /* D light */
-
- max_lspher = 0.0000926 / (max_lspher * max_lspher);
- max_osc = 0.0025;
- max_lchrom = max_lspher;
-#ifndef ACCURACY
- }
-
- printf("Stop the timer:\007");
- //gets(tbfr);
-#endif
-
- /* Now evaluate the accuracy of the results from the last ray trace */
-
- sprintf(outarr[0], "%15s %21.11f %14.11f",
- "Marginal ray", od_sa[0][0], od_sa[0][1]);
- sprintf(outarr[1], "%15s %21.11f %14.11f",
- "Paraxial ray", od_sa[1][0], od_sa[1][1]);
- sprintf(outarr[2],
- "Longitudinal spherical aberration: %16.11f",
- aberr_lspher);
- sprintf(outarr[3],
- " (Maximum permissible): %16.11f",
- max_lspher);
- sprintf(outarr[4],
- "Offense against sine condition (coma): %16.11f",
- aberr_osc);
- sprintf(outarr[5],
- " (Maximum permissible): %16.11f",
- max_osc);
- sprintf(outarr[6],
- "Axial chromatic aberration: %16.11f",
- aberr_lchrom);
- sprintf(outarr[7],
- " (Maximum permissible): %16.11f",
- max_lchrom);
-
- /* Now compare the edited results with the master values from
- reference executions of this program. */
-
- errors = 0;
- for (i = 0; i < 8; i++) {
- if (strcmp(outarr[i], refarr[i]) != 0) {
-#ifdef ACCURACY
- printf("\nError in pass %ld for results on line %d...\n",
- passes, i + 1);
-#else
- printf("\nError in results on line %d...\n", i + 1);
-#endif
- printf("Expected: \"%s\"\n", refarr[i]);
- printf("Received: \"%s\"\n", outarr[i]);
- printf("(Errors) ");
- k = strlen(refarr[i]);
- for (j = 0; j < k; j++) {
- printf("%c", refarr[i][j] == outarr[i][j] ? ' ' : '^');
- if (refarr[i][j] != outarr[i][j])
- errors++;
- }
- printf("\n");
- }
- }
-#ifdef ACCURACY
- }
-#else
- if (errors > 0) {
- printf("\n%d error%s in results. This is VERY SERIOUS.\n",
- errors, errors > 1 ? "s" : "");
- } else
- printf("\nNo errors in results.\n");
-#endif
-
- return 0;
-}
+++ /dev/null
-#include <math.h>
-
-float a;
-
-int main()
-{
- /* tests for problems in x87 simulator when results of a call are not
- * used */
- float b = a;
- sqrt(a);
- printf("%f\n", b);
- return 0;
-}
+++ /dev/null
-int a_number()
-{
- return 7;
-}
-
-void a_m_serial()
-{
- int n, a_number();
- n= a_number();
-}
-
-int main()
-{
- a_m_serial();
- printf("Result: %d\n", a_number());
- return 0;
-}
+++ /dev/null
-int f(void)
-{
-label:
- printf("bla\n");
- goto label;
-
- return 0;
-}
-
-int main(void)
-{
- return 0;
-}
+++ /dev/null
-/*$ -fno-inline $*/
-/* codeselector produces invalid AM for cmov */
-
-#include <stdio.h>
-
-int k = 20;
-
-int func(void)
-{
- k = 42;
- return 1;
-}
-
-int main(int argc, char **argv)
-{
- int val = k;
- int res;
- if(func()) {
- res = val;
- } else {
- res = 20;
- }
- printf("Res: %d (should be 20)\n", res);
- return 0;
-}
+++ /dev/null
-
-
-int main(void) {
-
-
- int i = 100;
- int j = 99;
-
- int **zeiger;
- int *p[2];
-
- p[0] = &i;
- p[1] = &j;
- zeiger = &p[0];
-
- printf("%d %d \n",**zeiger, **(zeiger+1));
-
- return 0;
-}
+++ /dev/null
-
-
-int main(void) {
-
- int zahl = 100;
- float f = 3.14;
-
- zahl = (int)f;
- printf("%d \n", zahl );
-
- return 0;
-}
+++ /dev/null
-
-int main(void)
-{
- int g = 0;
- int h = !g;
- printf("%d %d\n", g, h);
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-int main()
-{
- int i, n=3 , v, dig, set;
-
- //printf ("Enter n: ");
- //scanf ("%d", &n);
-
- v = 1 << n;
-
- for (i=0; i < v; i++) {
- set = i ^ (i>>1);
-
- printf(" i: %d set: %d \n",i,set);
- for (dig=1 << (n-1); dig; dig >>= 1)
- {
- printf("\ni: %d v: %d dig: %d set:%d\n",i,v,dig, set);
- printf (" %d", ((set & dig) ? 1 : 0));
- printf("\ni: %d v: %d dig: %d set:%d\n",i,v,dig, set);
- }
- printf ("\n");
- }
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-int main() /* prints all subsets of bit vector v in numerical order */
-{
- int u=0, v = 5;
-
- //printf( "Enter bit vector v: ");
- //scanf( "%d", &v );
-
- do
- printf("%d\n",u);
- while(u=(u-v)&v);
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-int main(void) {
-
- float a;
- float c;
-
- for (a=0; a<7; a++) {
- c = a;
- }
-
- printf("%f %f\n", a, c);
-
- return 0;
-}
+++ /dev/null
-struct x {
- int a;
- int b;
-} ;
-
-typedef struct x X;
-
-X test(void);
-
-
-int main(void) {
-
- X y;
- y = test();
- printf("%d %d\n", y.a, y.b);
-
- return 0;
-}
-
-X test(void) {
- X a;
- a.a = 2;
- a.b = 3;
- return(a);
-}
+++ /dev/null
-#include <stdio.h>
-
-void a(void);
-void b(void);
-
-int main(void) {
- a();
- printf("\n");
- return 0;
-}
-
-void a(void) {
- goto a;
-
-a:
- printf("x");
- b();
- return;
-
-b:
- printf("y");
- b();
- return;
-}
-
-void b(void) {
- goto b;
-
-a:
- printf("k");
- return;
-
-b:
- printf("l");
- return;
-}
+++ /dev/null
-#include <stdio.h>
-
-int main(void) {
-
- long long a = 0x0123456789012345;
- int b = 23;
- int c;
-
- c = a % b;
-
- printf("%d\n", c);
-
- return 0;
-}
+++ /dev/null
-void xyz (void);
-
-int t = -1;
-
-int main(void) {
- printf("%d\n", t);
- xyz();
- printf("%d\n", t);
-
- return 0;
-}
-
-
-void xyz (void) {
- t++;
-}
+++ /dev/null
-#include <stdio.h>
-
-int main()
-{
- const char *s = "no compiler is perfect";
- const char *t = s;
- char c = *t;
-
- for( ; !((c == ' ') && (c != '\"')); t++) {
- c = *t;
- }
-
- printf("Res: %s\n", t);
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-unsigned int c = 0xffffffff;
-unsigned short b;
-
-int main()
-{
- b = c;
- printf("%x\n", b);
- return 0;
-}
+++ /dev/null
-#include <stdlib.h>
-#include <math.h>
-
-int i = 0;
-int *p1 = &i;
-
-int main()
-{
- *p1 = 1066;
- if(p1 != &i)
- abort();
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-static char string[2048] = "";
-static char string2[2048] = "It's indeed okay";
-
-int main()
-{
- sprintf(string, "This is a very long sentence to test, whether the compiler crashs because of obscure bugs... If you can read it all until the exclamation mark, then your compiler is probably okay!");
-
- puts(string);
- puts(string2);
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-char *p = "\xFF";
-
-int main() {
- printf("Result: %d (should be 255)\n", (unsigned char) (*p++));
- return 0;
-}
+++ /dev/null
-#define MIN_MATCH 3
-#define HASH_BITS 15
-#define HASH_SIZE (unsigned)(1<<HASH_BITS)
-#define HASH_MASK (HASH_SIZE-1)
-#define H_SHIFT ((HASH_BITS+MIN_MATCH-1)/MIN_MATCH)
-
-static __inline
-void UPDATE_HASH(unsigned *h, unsigned c) {
- *h = (((*h) << H_SHIFT) ^ (c)) & HASH_MASK;
-}
-
-static unsigned ins_h = 123;
-static const char *window = "Hello Test";
-
-int main() {
- int j;
-
- ins_h = 0;
- for(j = 0; j < MIN_MATCH-1; j++)
- UPDATE_HASH(&ins_h, window[j]);
-
- rand();
-
- printf("Result: %d\n", ins_h);
-
- return 0;
-}
+++ /dev/null
-/*
- * compiler with -f no-inline
- */
-#include <stdio.h>
-
-#ifdef __GNUC__
-#define NO_INLINE __attribute__((noinline))
-#else
-#define NO_INLINE __declspec(noinline)
-#endif
-
-static NO_INLINE void func(float a, float b, float *c, float *d);
-
-static void func(float a, float b, float *c, float *d) {
- *c = a;
- *d = b;
-}
-
-int main(int argc, char *argv[]) {
- float a, b;
-
- func(3.0f, 4.0f, &a, &b);
-
- printf("a = %f (should be 3.0)\n", a);
- printf("b = %f (should be 4.0)\n", b);
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-#include <math.h>
-
-int end = 4;
-float k[] = { 2.8, 2.8, 2.8, 2.8, 2.8 };
-
-void print_fpcw()
-{
-#ifdef __i386__
- int val = 0;
- __asm__ (
- "subl $4, %%esp\n"
- "fnstcw (%%esp)\n"
- "movzwl (%%esp), %0\n"
- "addl $4, %%esp\n" : "=r"(val));
-
- printf("%x\n", val);
-#else
- printf("%d\n", (int) k[0]);
-#endif
-}
-
-int main()
-{
- int i;
- int res = 0;
-
- for(i = 0; i < end; ++i) {
- print_fpcw();
- res = (int) k[i];
- }
- print_fpcw();
- printf("%d\n", res);
-
- return 0;
-}
+++ /dev/null
-struct blup {
- char str[16];
- int dummy;
-};
-
-struct blup dumm[] = { { "Hallo" }, { "Welt" } };
-
-int main() {
- puts(dumm[0].str);
- puts(dumm[1].str);
- return 0;
-}
+++ /dev/null
-#include <wchar.h>
-
-const wchar_t AmmoCaliber[][20] =
-{
- L"BlupBlupBlupBlupBlup",
- L".38 Kal",
-};
-
-
-int main(void)
-{
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-#include <math.h>
-
-int main(int argc, char ** argv) {
- float a = 0;
-
- while(argc--) {
- a += 1;
- }
-
- printf("%f\n", a);
-
- return 0;
-}
+++ /dev/null
-/* The tarval module fails to negate the constant and returns TV_OVERFLOW_BAD
- * when optimising the comparison (-x < 0 -> x > 0). It is not expected that
- * the negation fails and an assertion while constructing the negated constant
- * is triggered */
-
-int f(double x)
-{
- return -x < 0;
-}
-
-
-int main(void)
-{
- return 0;
-}
+++ /dev/null
-/* The compound initialisation code asserts when a wide char array in a struct
- * gets initialised with a wide string literal which is - not counting the \0 -
- * as long as the array */
-
-#include <wchar.h>
-
-struct s {
- wchar_t x[30];
- short y;
-};
-
-
-struct s x[][21] = {
- { L"Exactly 30 chars long", 1 }
-};
-
-
-int main(void)
-{
- return 0;
-}
+++ /dev/null
-#include <assert.h>
-#include <stdio.h>
-
-#define SF_SMOKE_EFFECTS_TEMP_FILE_EXISTS 0x00100000 //Temp File starts with sm_
-#define SF_LIGHTING_EFFECTS_TEMP_FILE_EXISTS 0x00200000 //Temp File starts with l_
-
-#define SF_REVEALED_STATUS_TEMP_FILE_EXISTS 0x01000000 //Temp File starts with v_
-#define SF_DOOR_STATUS_TEMP_FILE_EXISTS 0x02000000 //Temp File starts with ds_
-#define SF_ENEMY_PRESERVED_TEMP_FILE_EXISTS 0x04000000 //Temp File starts with e_
-#define SF_CIV_PRESERVED_TEMP_FILE_EXISTS 0x08000000 //Temp File starts with c_
-#define SF_ITEM_TEMP_FILE_EXISTS 0x10000000 //Temp File starts with i_
-#define SF_ROTTING_CORPSE_TEMP_FILE_EXISTS 0x20000000 //Temp File starts with r_
-#define SF_MAP_MODIFICATIONS_TEMP_FILE_EXISTS 0x40000000 //Temp File starts with m_
-#define SF_DOOR_TABLE_TEMP_FILES_EXISTS 0x80000000 //Temp File starts with d_
-
-#define MAPS_DIR "maps"
-
-void f(unsigned int uiType)
-{
- //Convert the current sector location into a file name
- const char* zTempName = "blub";
- char pMapName[512];
-
- switch (uiType)
- {
- case SF_ITEM_TEMP_FILE_EXISTS:
- sprintf( pMapName, "%s/i_%s", MAPS_DIR, zTempName);
- break;
-
- case SF_ROTTING_CORPSE_TEMP_FILE_EXISTS:
- sprintf( pMapName, "%s/r_%s", MAPS_DIR, zTempName);
- break;
-
- case SF_MAP_MODIFICATIONS_TEMP_FILE_EXISTS:
- sprintf( pMapName, "%s/m_%s", MAPS_DIR, zTempName);
- break;
-
- case SF_DOOR_TABLE_TEMP_FILES_EXISTS:
- sprintf( pMapName, "%s/d_%s", MAPS_DIR, zTempName);
- break;
-
- case SF_REVEALED_STATUS_TEMP_FILE_EXISTS:
- sprintf( pMapName, "%s/v_%s", MAPS_DIR, zTempName);
- break;
-
- case SF_DOOR_STATUS_TEMP_FILE_EXISTS:
- sprintf( pMapName, "%s/ds_%s", MAPS_DIR, zTempName);
- break;
-
- case SF_ENEMY_PRESERVED_TEMP_FILE_EXISTS:
- sprintf( pMapName, "%s/e_%s", MAPS_DIR, zTempName);
- break;
-
- case SF_CIV_PRESERVED_TEMP_FILE_EXISTS:
- sprintf( pMapName, "%s/cc_%s", MAPS_DIR, zTempName);
- break;
-
- case SF_SMOKE_EFFECTS_TEMP_FILE_EXISTS:
- sprintf( pMapName, "%s/sm_%s", MAPS_DIR, zTempName);
- break;
-
- case SF_LIGHTING_EFFECTS_TEMP_FILE_EXISTS:
- sprintf( pMapName, "%s/l_%s", MAPS_DIR, zTempName);
- break;
-
- default:
- assert(0);
- break;
- }
-}
-
-int main()
-{
- return 0;
-}
+++ /dev/null
-/* Wrong stabs */
-
-#define MAX_FILENAME_LEN 48
-
-typedef unsigned char BOOLEAN;
-typedef unsigned int UINT32;
-typedef unsigned char UINT8;
-typedef void* HVOBJECT;
-
-
-typedef struct
-{
- char ubFilename[MAX_FILENAME_LEN];
- BOOLEAN fLoaded;
- UINT32 uiIndex;
- UINT8 ubFlags;
- UINT8 ubNumberOfFrames;
- HVOBJECT hVObject;
-} CursorFileData;
-
-
-CursorFileData blub;
-
-
-int main(void)
-{
- return 0;
-}
+++ /dev/null
-/* fmt and all further parameters must be passed on the stack even for regparams */
-#include <stdio.h>
-#include <stdarg.h>
-
-static void f(const char* fmt, ...)
-{
- va_list va;
- va_start(va, fmt);
- vprintf(fmt, va);
- va_end(va);
-}
-
-
-int main(void)
-{
- f("Hallo, %s!\n", "Welt");
- return 0;
-}
+++ /dev/null
-/* Crash in ia32 floating point code emitter */
-
-int f(float x)
-{
- return x != -1;
-}
-
-
-int main(void)
-{
- return f(-1);
-}
+++ /dev/null
-#include <stdio.h>
-
-int k = 123;
-
-int main()
-{
- if(k & 16) {
- puts("correct");
- return 0;
- }
- return 1;
-}
+++ /dev/null
-#include <stdlib.h>
-#include <stdio.h>
-
-static unsigned hash_ptr(const void *ptr)
-{
- unsigned ptr_int = ((const char*) ptr - (const char*) NULL);
- return ptr_int >> 3;
-}
-
-void *p = (void*) 0xdeadbeef;
-
-int main()
-{
- printf("0x%x (shoulde be 0x1bd5b7dd)\n", hash_ptr(p));
-
- return 0;
-}
+++ /dev/null
-/* testjmp optimizer invalid */
-
-#include <stdio.h>
-
-void *p = (void*) 0x12345;
-void *p2 = 0;
-
-int main()
-{
- void *mp = p;
- void *mp2 = p2;
- if(mp && mp2) {
- printf("1\n");
- } else if (mp) {
- printf("2\n");
- } else {
- printf("3\n");
- }
- return 0;
-}
+++ /dev/null
-/* tailrec optimisation failing on struct parameters */
-
-typedef struct {
- int a, b, c;
-} stru;
-
-void f(int a, const stru x) {
- if(a == 100)
- return;
- f(a+1, x);
-}
-
-int main() {
- return 0;
-}
+++ /dev/null
-/* Very subtle if conversion bug: print is correct, return value is incorrect */
-
-#ifdef __GNUC__
-#define NO_INLINE __attribute__((noinline))
-#else
-#define NO_INLINE __declspec(noinline)
-#endif
-
-static inline int f(unsigned int x)
-{
- if (x == 0xFFFFFFFF)
- return 0;
- else
- return x;
-}
-
-
-unsigned int q = 89497;
-
-
-int NO_INLINE main2(void)
-{
- printf("%d = 1\n", f(q) != 0);
- return f(q) != 0;
-}
-
-
-int main(void)
-{
- return !main2();
-}
+++ /dev/null
-#include <stdio.h>
-#include <assert.h>
-
-unsigned int p0 = 0;
-unsigned int p1 = 42;
-
-int simpler(void)
-{
- if (p0 != p1)
- if (p0 == 0)
- return -1;
- else
- return 1;
- return 0;
-}
-
-int compare_string(char *CompValue, char *ValuePtr)
-{
- int i = 0;
- unsigned char *p0 = (unsigned char *)CompValue;
- unsigned char *p1 = (unsigned char *)ValuePtr;
-
- for (i = 0; i == 0 && *p0 != '\0' && *p1 != '\0'; p0++, p1++)
- {
- if (*p0 != *p1)
- if (*p0 < *p1)
- i = -1;
- else
- i = 1;
- }
-
- if (i == 0)
- if (*p0 != *p1)
- if (*p0 == '\0')
- i = -1;
- else
- i = 1;
-
- return(i);
-}
-
-int main()
-{
-#define test(a,b,shouldbe) { int res = compare_string(a, b); printf("Compare %s, %s -> %d (should be %d)\n", a, b, res, shouldbe); assert(res == shouldbe); }
- test("a", "b", -1);
- test("", "", 0);
- test("Rothe", "Rother", -1);
- test("hallo", "hallo", 0);
- test("hallo", "welt", -1);
- test("welt", "hallo", 1);
-
- printf("Simpler: %d\n", simpler());
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-#include <stdlib.h>
-
-#ifdef __GNUC__
-#define NO_INLINE __attribute__((noinline))
-#else
-#define NO_INLINE __declspec(noinline)
-#endif
-
-float NO_INLINE t2()
-{
- float a;
- return a + 12.54f;
-}
-
-float NO_INLINE t()
-{
- exit(0);
-}
-
-int main()
-{
- t();
- t2();
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-int a[10];
-
-int main() {
- int *p = &a[0];
- int *q = &a[9];
-
- printf("%d\n", p - q);
- return 0;
-}
+++ /dev/null
-#ifdef __GNUC__
-#define NO_INLINE __attribute__((noinline))
-#else
-#define NO_INLINE __declspec(noinline)
-#endif
-
-
-int NO_INLINE f(int y, int z)
-{
- int x = 0;
- if (y) x++;
- if (z) x++;
- return x;
-}
-
-
-int main(void)
-{
- printf("%d (0)\n", f(0, 0));
- printf("%d (1)\n", f(0, 1));
- printf("%d (1)\n", f(1, 0));
- printf("%d (2)\n", f(1, 1));
- return 0;
-}
+++ /dev/null
-/* register allocator fails to resolve IMul Constraints correctly */
-#include <stdlib.h>
-#include <stdio.h>
-
-typedef struct
-{
- short sX;
- short sY;
- int iLightID;
-} EXPLOSIONTYPE;
-
-static void GenerateExplosionFromExplosionPointer(EXPLOSIONTYPE* pExplosion)
-{
- short sX = pExplosion->sX;
- short sY = pExplosion->sY;
-
- if (pExplosion->iLightID = rand())
- {
- printf("Blup: %d %d %d\n", pExplosion->iLightID, sX / 10, sY / 10);
- }
-}
-
-
-void f(void)
-{
- GenerateExplosionFromExplosionPointer(0);
-}
-
-
-int main(void)
-{
- return 0;
-}
+++ /dev/null
-
-#define FABS(x) fabs(x)
-#define FLOOR(x) floor(x)
-
-double One = 1.0;
-double C, Y, Z;
-
-int main()
-{
- Y = One;
- Z = 0.00000000000000011102;
- printf("Y: %20.20f Z: %20.20f\n", Y, Z);
- /* ... D is power of 1/Radix < 1. */
- do {
- C = Y;
- Y = Z;
- Z = Y * Y;
- //printf("Y: %30.30f Z:%30.30f\n", Y, Z);
- } while ((Y > Z) && (Z + Z > Z));
-
- printf("Res. %20.20f - %20.20f\n", Z, Y);
- return 0;
-}
+++ /dev/null
-/* different interpretation of strict conv */
-
-float C1 = 15;
-float C2 = 1;
-float C3 = 0.0099999997764825821;
-//double C4 = 0.12999999523162842;
-
-int main()
-{
- float C4 = 0.12999999523162842;
- C4 += C1 * C2 * C3;
- printf("%.30f\n", C4);
- return 0;
-}
+++ /dev/null
-/* float problems */
-#include <stdio.h>
-
-double Radix = 2.0;
-double One = 1.0;
-double Zero = 0.0;
-double U1;
-double W;
-double Y;
-double Precision;
-
-int main() {
- W = One;
- Precision = Zero;
- do {
- Precision = Precision + One;
- W = W * Radix;
- Y = W + One;
- } while((Y - W) == One);
-
- U1 = One / W;
- printf("BLa. %.30e\n", U1);
-
-
- return 0;
-}
+++ /dev/null
-//double C2 = 74.739288330078125;
-
-int main()
-{
- float cost = 74.739288330078125;
- double square = cost * cost;
- //C2 = square;
- printf("Res: %.20f\n", square);
- return 0;
-}
+++ /dev/null
-#define IM 2147483648u
-
-unsigned int current_random1 = 1892341778;
-int imax1 = 403;
-unsigned int current_random2 = 4247132568;
-int imax2 = 403;
-
-int main()
-{
- int ival1 = current_random1 & (IM - 1);
- ival1 = (int) ((float) ival1 * (float) (imax1 + 0.999) / (float) IM);
- int ival2 = current_random2 & (IM - 1);
- ival2 = (int) ((float) ival2 * (float) (imax2 + 0.999) / (float) IM);
-
- printf("Res1: %d\n", ival1);
- printf("Res2: %d\n", ival2);
-
- return 0;
-}
+++ /dev/null
-#define IM 2147483648u
-
-unsigned int current_random2 = 4247132568;
-int imax2 = 403;
-
-int main()
-{
- int ival2 = current_random2 & (IM - 1);
- double intermediate = ((float) ival2 * (float)(imax2 + 0.999));
- printf("%3.15e => %u\n", intermediate, (unsigned int) intermediate);
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-struct bitfield {
- unsigned int code : 8;
- unsigned int bit1 : 1;
- unsigned int bit2 : 1;
- unsigned int bit3 : 1;
-} bf = {7, 1, 0, 1 };
-
-int main()
-{
- printf("Res: %d (should be 7)\n", bf.code);
- return 0;
-}
+++ /dev/null
-/* tarval rounding wrong with fp-strict */
-
-int main()
-{
- float cost = 74.739288330078125;
- double square = cost * cost;
- //C2 = square;
- printf("cost: %.20f\n", cost);
- printf("square: %.20f\n", square);
- return 0;
-}
+++ /dev/null
-/* Incorrect values when using C99 style initialisation */
-
-int tab[] = {
- [5] = 23
-};
-
-
-int main(void)
-{
- int i = tab[5];
- printf("%d (23)\n", i);
- return i != 23;
-}
+++ /dev/null
-/* Frontend assert while building initialisers */
-
-union {
- int i;
- char a[4];
-} blub = {
- .a[2] = 9,
- .i = 23
-};
-
-int main()
-{
- return 0;
-}
+++ /dev/null
-/* Emitter dies while emitting initialisers */
-
-union {
- int i;
- char a[4];
-} blub = {
- .i = 23,
- .a[2] = 9
-};
-
-int main()
-{
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-void te(int *bla) {
- int *blup = bla;
-
- while(blup) {
- switch(*blup) {
- case 20:
- printf("Joa: %d\n", *(blup+1));
- blup = 0;
- break;
- }
- }
-}
-
-int main()
-{
- int arr[] = { 20, 2, 4, 5, 6, 8 };
-
- te(arr);
-
- return 0;
-}
+++ /dev/null
-/************************************************************************
-* Program: maxps.c
-* Function: Add 2 vectors (lying in memory) and store the result in
-* a another vector in memory.
-* Used as a test for the simd optimization.
-* Author: Andreas Schoesser
-* Date: 2007-02-13
-************************************************************************/
-
-#include <stdio.h>
-#include <malloc.h>
-#include <stdlib.h>
-
-float maxps();
-float ueberlappung();
-//void vadd_loop();
-//void array_test(int *a[]);
-
-int main()
-{
- int a[5][5];
-
- a[1][1] = 20;
-
- srand(12345);
-
- printf("1. vload -> vadd -> vstore\n===================\n\n");
- ueberlappung();
-
- printf("2. vload -> vadd -> vstore, multi dimensional array, in loop\n==========================================\n\n");
- // vadd_loop();
-
- // array_test(a);
-
- return 0;
-}
-
-float ueberlappung()
-{
- float a[4], b[4], c[4], d[4];
- float a0, a1, a2, a3;
- float b0, b1, b2, b3;
- float c0, c1, c2, c3;
- float sp1, sp2;
- int i;
-
- for(i = 0; i < 4; i++)
- {
- a[i] = rand() % 10;
- b[i] = rand() % 10;
- c[i] = rand() % 10;
- d[i] = rand() % 10;
- }
-
-
-
- // find vload 2x
- sp1 = a[0] * b[0] + a[1] * b[1] + a[2] * b[2] + a[3] * b[3];
-
- // find vmul
- sp2 = b[0] * d[0] + b[1] * d[1] + b[2] * d[2] + b[3] * d[3];
-
- // Usage to prevent optimizations other than SIMD opt
- for(i = 0; i < 4; i++)
- printf("%f %f %f %f\n", a[i], b[i], c[i], d[i]);
- printf("\n");
- return(sp1 + sp2);
-}
+++ /dev/null
-#include <stdio.h>
-#include <stdarg.h>
-#include <stdlib.h>
-
-union foo {
- float blop;
- int bla;
- struct {
- int a, b, c;
- } jup;
- const char *str;
-};
-
-typedef union foo *tree;
-
-enum bla {
- BLA_1,
- BLA_2,
- BLA_3,
- BLA_4
-};
-
-const char* foo(enum bla type, tree dummy, ...) {
- va_list ap;
- const char *s1;
-
- va_start(ap, dummy);
- s1 = va_arg(ap, const char*);
- va_end(ap);
-
- return s1;
-}
-
-union foo bla = { .str = "bla" };
-
-int main()
-{
- const char *res = foo(BLA_2, &bla, "everything ok");
- puts(res);
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-struct bitfield {
- unsigned int code : 8;
- unsigned int bit1 : 1;
- unsigned int bit2 : 1;
- unsigned int bit3 : 1;
-} bf = {7, 1, 0, 1 };
-
-int main()
-{
- bf.code = 0xffffffff;
- printf("Res: %d (should be 255)\n", bf.code);
- printf("R2: %d %d %d (should be 1 0 1)\n", bf.bit1, bf.bit2, bf.bit3);
- bf.code += 1;
- printf("Res: %d (should be 0)\n", bf.code);
- return 0;
-}
+++ /dev/null
-/*$ -fno-inline $*/
-/* 64 bit problems in beabi (should be worked around by now) */
-#include <assert.h>
-
-extern int func1(int version, const char *path, unsigned long long *ptr)
-{
- (void) version;
- (void) path;
- (void) ptr;
- return 42;
-}
-
-extern inline int func2(const char *path, unsigned long long dev)
-{
- return func1(1, path, &dev);
-}
-
-int main()
-{
- int res = func2("bla", 1);
- assert(res == 42);
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-typedef struct sv {
-}SV ;
-
-typedef struct hek HEK;
-struct hek {
- char hek_key[4];
-};
-
-HEK hekimek;
-
-int main() {
- (*(SV**) hekimek.hek_key) = (SV*) -2;
- printf("Result: %d (expected -2)\n", (int) (*(SV**) hekimek.hek_key));
- return 0;
-}
+++ /dev/null
-typedef struct rtx_def
-{
- unsigned short code;
- int mode : 8;
- int rtint;
-} *rtx;
-
-struct rtx_def bla;
-
-void t(int num_eliminable, int n_reloads) {
- register rtx insn = &bla;
- int did_elimination = 0;
-
- if(num_eliminable)
- did_elimination = rand();
-
- insn->mode = did_elimination ? 42 : insn->mode == 6 ? 6 : 0;
-}
-
-int main()
-{
- bla.rtint = 8;
- bla.mode = 6;
- printf("Before: %d %d\n", bla.mode, bla.rtint);
- t(0, 1);
- printf("After: %d %d\n", bla.mode, bla.rtint);
- return 0;
-}
+++ /dev/null
-int floor_log2_wide (unsigned int x)
-{
- x >>= 1;
- return x;
-}
-
-unsigned test_div(int x) {
- x /= -1;
- return x;
-}
-
-int X;
-
-int main()
-{
- printf("Res: %d\n", floor_log2_wide(4294967251));
- printf("Res: %d\n", test_div(-5));
- printf("Res: %d\n", -5%-1);
- printf("Res: %d\n", +5%-1);
- printf("Res: %d\n", -5%+1);
- printf("Res: %d\n", +5%+1);
- printf("Res: %d\n", X % -1);
- return 0;
-}
+++ /dev/null
-short ii = 230;
-
-int main() {
- short i = ii & 255;
- printf("res = %d (should be 230)\n", i);
- return 0;
-}
+++ /dev/null
-#include <alloca.h>
-#include <assert.h>
-
-int main()
-{
- char *b1 = alloca(13);
- int i;
- int lastoffs = 0;
-
- for(i = 0; i < 5; ++i) {
- char *bfs = alloca(24);
- int offset = b1 - bfs;
- memset(bfs, 0, 24);
- assert(offset > lastoffs);
- lastoffs = offset;
- }
-
- return 0;
-}
+++ /dev/null
-float f(float x)
-{
- return x * 2.0f;
-}
-
-
-int main(void)
-{
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-static void f(int i)
-{
- printf("%d (should be 42)\n", i);
-}
-
-void (*x)(int) = f;
-
-int main(void)
-{
- x(42);
- return 0;
-}
+++ /dev/null
-#include <stdlib.h>
-#include <stdio.h>
-#include <assert.h>
-
-typedef struct linked {
- struct linked *next;
-} linked;
-
-linked* t(linked *val) {
- printf("start\n");
-
- if(val == NULL)
- return NULL;
-
- void *res = t(val->next);
- if(res)
- return res;
- return val;
-}
-
-int main()
-{
- linked a, b, c;
- a.next = &b;
- b.next = &c;
- c.next = NULL;
- t(&a);
- return 0;
-}
+++ /dev/null
-#include <string.h>
-#include <stdlib.h>
-
-#define ZONEID 0x1d4a11
-
-typedef struct memblock_s {
- int size; // including the header and possibly tiny fragments
- int tag; // a tag of 0 is a free block
- struct memblock_s *next, *prev;
- int id; // should be ZONEID
-#ifdef ZONE_DEBUG
- zonedebug_t d;
-#endif
-} memblock_t;
-
-typedef struct {
- int size; // total bytes malloced, including header
- int used; // total bytes used
- memblock_t blocklist; // start / end cap for linked list
- memblock_t *rover;
-} memzone_t;
-
-typedef char byte;
-
-static void Z_ClearZone( memzone_t *zone, int size ) {
- memblock_t *block;
-
- // set the entire zone to one free block
-
- zone->blocklist.next = zone->blocklist.prev = block =
- (memblock_t *)( (byte *)zone + sizeof(memzone_t) );
-#if 0
- zone->blocklist.tag = 1; // in use block
- zone->blocklist.id = 0;
- zone->blocklist.size = 0;
- zone->rover = block;
- zone->size = size;
- zone->used = 0;
-#endif
-
- block->prev = block->next = &zone->blocklist;
- block->tag = 0; // free block
- block->id = ZONEID;
- block->size = size - sizeof(memzone_t);
-}
-
-void Com_InitSmallZoneMemory( void ) {
- int s_smallZoneTotal = 512 * 1024;
- // bk001205 - was malloc
- memzone_t *smallzone = calloc( s_smallZoneTotal, 1 );
- if ( !smallzone ) {
- abort();
- }
- Z_ClearZone( smallzone, s_smallZoneTotal );
-
- return;
-}
-
-int main(void)
-{
- Com_InitSmallZoneMemory();
- return 0;
-}
+++ /dev/null
-static void crashme(void)
-{
- * ( int * ) 0 = 0x12345678;
-}
-
-int main(int argc)
-{
- if(argc > 1)
- crashme();
- return 0;
-}
+++ /dev/null
-int randn = -1271796327;
-double value = 4294967295;
-
-int main(void) {
- double res = (double) (randn % (unsigned int) value);
- printf("Res: %f\n", res);
- return 0;
-}
+++ /dev/null
-double a[1000000];
-unsigned int b[1000000];
-double a2[1000000];
-unsigned int b2[1000000];
-
-int main() {
- int i;
-
- for(i = 0; i < 123; ++i) {
- a[i] = b[i];
- a2[i] = b2[i];
- }
-
- return 0;
-}
+++ /dev/null
-/*****************************************************************************
- * Program: sad.c
- * Function: New implementation of the intel application note
- * AP-940: "Block matching in Motion estimation Algorithms
- * using Streaming SIMD Extensions 3"
- * We changed:
- * - We used local arrays instead of pointer arithmetic
- * because of the limited capability of the memory disambiguator
- * - Used if/else instead of abs function since we can't
- * use function calls in specification
- * - Unrolled the inner loop manually since our loop
- * unroller does not work so well.
- * Used as a test for the simd optimization.
- * TODO: - Maybe use the "restrict" keyword to implement pointer
- * arithmetic
- * Author: Andreas Schoesser
- * Date: 2007-08-06
- *****************************************************************************/
-
-#include <stdio.h>
-#include <malloc.h>
-#include <stdlib.h>
-#include <time.h>
-
-unsigned int sad(int test_blockx, int test_blocky, int *best_block_x, int *best_block_y, int iterations);
-
-main()
-{
- int best_block_x, best_block_y;
- unsigned int min_diff;
- int iterations = 2;
-
- printf("PSADBW Example\n--------------\n\n");
-
- printf("Executing 'motion estimation' %d times...\n\n", iterations);
- min_diff = sad(0, 0, &best_block_x, &best_block_y, iterations);
-
- printf("MinDiff: %u\nBest X: %d\nBest Y: %d\n", min_diff, best_block_x, best_block_y);
-}
-
-unsigned int sad(int test_blockx, int test_blocky, int *best_block_x, int *best_block_y, int iterations)
-{
- unsigned char b[256][256];
-
- unsigned char a0, a1, a2, a3, a4, a5, a6, a7, a8, a9, a10, a11, a12, a13, a14, a15;
- unsigned char b0, b1, b2, b3, b4, b5, b6, b7, b8, b9, b10, b11, b12, b13, b14, b15;
-
- int i, x, y, blocky;
- unsigned tmp_diff, min_diff = 0xFFFFFFFF; // MAX_UINT
-
- // Fill in some random values to compare
- for(x = 0; x < 256; x++)
- for(y = 0; y < 256; y++)
- b[y][x] = (unsigned char) rand() % 255;
-
- // Execute Block matching 100 times
- for(i = 0; i < iterations; i++)
- {
- // Iterate over whole frame, x,y=coords of current block
- for(x = 1; x < 256 - 16; x++)
- for(y = 0; y < 256 - 16; y++)
- {
- tmp_diff = 0;
-
- // Compare current Block with reference block
- for(blocky = 0; blocky < 16; blocky++)
- {
- // Vektor Loads
- a0 = b[blocky][0]; a1 = b[blocky][1]; a2 = b[blocky][2]; a3 = b[blocky][3]; a4 = b[blocky][4]; a5 = b[blocky][5]; a6 = b[blocky][6]; a7 = b[blocky][7]; a8 = b[blocky][8]; a9 = b[blocky][9]; a10 = b[blocky][10]; a11 = b[blocky][11]; a12 = b[blocky][12]; a13 = b[blocky][13]; a14 = b[blocky][14]; a15 = b[blocky][15];
- b0 = b[blocky + y][x + 0]; b1 = b[blocky + y][x + 1]; b2 = b[blocky + y][x + 2]; b3 = b[blocky + y][x + 3]; b4 = b[blocky + y][x + 4]; b5 = b[blocky + y][x + 5]; b6 = b[blocky + y][x + 6]; b7 = b[blocky + y][x + 7]; b8 = b[blocky + y][x + 8]; b9 = b[blocky + y][x + 9]; b10 = b[blocky + y][x + 10]; b11 = b[blocky + y][x + 11]; b12 = b[blocky + y][x + 12]; b13 = b[blocky + y][x + 13]; b14 = b[blocky + y][x + 14]; b15 = b[blocky + y][x + 15];
-
- // psadpw, would be nice if this could be done by loop unrolling
- tmp_diff += ((a0 > b0) ? (a0 - b0) : (b0 - a0)) +
- ((a1 > b1) ? (a1 - b1) : (b1 - a1)) +
- ((a2 > b2) ? (a2 - b2) : (b2 - a2)) +
- ((a3 > b3) ? (a3 - b3) : (b3 - a3)) +
- ((a4 > b4) ? (a4 - b4) : (b4 - a4)) +
- ((a5 > b5) ? (a5 - b5) : (b5 - a5)) +
- ((a6 > b6) ? (a6 - b6) : (b6 - a6)) +
- ((a7 > b7) ? (a7 - b7) : (b7 - a7)) +
- ((a8 > b8) ? (a8 - b8) : (b8 - a8)) +
- ((a9 > b9) ? (a9 - b9) : (b9 - a9)) +
- ((a10 > b10) ? (a10 - b10) : (b10 - a10)) +
- ((a11 > b11) ? (a11 - b11) : (b11 - a11)) +
- ((a12 > b12) ? (a12 - b12) : (b12 - a12)) +
- ((a13 > b13) ? (a13 - b13) : (b13 - a13)) +
- ((a14 > b14) ? (a14 - b14) : (b14 - a14)) +
- ((a15 > b15) ? (a15 - b15) : (b15 - a15));
- }
-
- // Check if the current block is least different
- if(min_diff > tmp_diff)
- {
- min_diff = tmp_diff;
- *best_block_x = x;
- *best_block_y = y;
- }
- }
- }
-
- return(min_diff);
-}
+++ /dev/null
-/************************************************************************
- * Program: scalar_product.c
- * Function: Calculates the scalar product of vector lying in memory
- * Used as a test for the simd optimization.
- * Author: Andreas Schoesser
- * Date: 2007-06-13
- ************************************************************************/
-
-#include <stdio.h>
-#include <malloc.h>
-#include <stdlib.h>
-#include <time.h>
-
-float scalar_product(float *a, float *b, unsigned int max_elements);
-
-main()
-{
- float res;
- int i, max_elements = 100;
- double d_zeitdauer;
-
- // Allocate memory and make sure pointers are aligned to 16 byte addresses
- char *a = malloc(16 + max_elements * sizeof(float));
- char *b = malloc(16 + max_elements * sizeof(float));
- float c;
- char *ca = &a[0] + 16 - (unsigned int) ((unsigned int) &a[0] % 16);
- char *cb = &b[0] + 16 - (unsigned int) ((unsigned int) &b[0] % 16);
-
- float *aa = (float *) ca;
- float *ab = (float *) cb;
-
- srand(0);
-
- printf("Scalar product\n==============\n\n");
-
- //printf("Array Position: %u, %u, %u, %u\n", a, b, aa, ba/*(unsigned int) &aa[0] % 16, (unsigned int) &ba[0] % 16*/);
-
- // Fill both arrays with random values
- for(i = 0; i < max_elements; i++)
- {
- aa[i] = (float) (rand() % 10);
- ab[i] = (float) (rand() % 10);
-
- //printf("(%g * %g) + ", a[i], b[i]);
- }
-
- res = scalar_product(aa, ab, max_elements);
-
- printf("\nResult: %g\n", res);
-}
-
-
-float scalar_product(float * a, float * b, unsigned int max_elements)
-{
- float res = 0;
- int i;
-
- for(i = 0; i < max_elements; i += 4) {
- res += a[i] * b[i];
- res += a[i + 1] * b[i + 1];
- res += a[i + 2] * b[i + 2];
- res += a[i + 3] * b[i + 3];
- }
-
- return res;
-}
+++ /dev/null
-typedef unsigned char UINT8;
-typedef signed short INT16;
-typedef unsigned short UINT16;
-typedef unsigned int UINT32;
-
-#define FROMRGB(r, g ,b) ((UINT32) (((UINT8) (r) | ((UINT16) (g) << 8)) | (((UINT32) (UINT8) (b)) << 16)))
-#define SGPGetRValue(rgb) ((UINT8) (rgb))
-#define SGPGetBValue(rgb) ((UINT8) ((rgb) >> 16))
-#define SGPGetGValue(rgb) ((UINT8) (((UINT16) (rgb)) >> 8))
-#define BLACK_SUBSTITUTE 0x0001
-
-
-float guiShadePercent;
-INT16 gusRedShift;
-INT16 gusGreenShift;
-INT16 gusBlueShift;
-INT16 gusRedMask;
-INT16 gusGreenMask;
-INT16 gusBlueMask;
-
-
-UINT16 Get16BPPColor(UINT32 RGBValue)
-{
- UINT8 r = SGPGetRValue(RGBValue);
- UINT8 g = SGPGetGValue(RGBValue);
- UINT8 b = SGPGetBValue(RGBValue);
-
- UINT16 r16 = (gusRedShift < 0 ? r >> -gusRedShift : r << gusRedShift);
- UINT16 g16 = (gusGreenShift < 0 ? g >> -gusGreenShift : g << gusGreenShift);
- UINT16 b16 = (gusBlueShift < 0 ? b >> -gusBlueShift : b << gusBlueShift);
-
- UINT16 usColor = (r16 & gusRedMask) | (g16 & gusGreenMask) | (b16 & gusBlueMask);
-
- if (usColor == 0 && RGBValue != 0) usColor = BLACK_SUBSTITUTE;
-
- return usColor;
-}
-
-
-void BuildShadeTable(void)
-{
- UINT16 red;
- UINT16 green;
- UINT16 blue;
-
- for (red = 0; red < 256; red += 4)
- {
- for (green = 0; green < 256; green += 4)
- {
- for (blue = 0; blue < 256; blue += 4)
- {
- Get16BPPColor(42);
- Get16BPPColor(FROMRGB(red * guiShadePercent, green * guiShadePercent, blue * guiShadePercent));
- }
- }
- }
-}
-
-
-int main(void)
-{
- BuildShadeTable();
- return 0;
-}
+++ /dev/null
-typedef struct s {
- char a;
- char b;
-} s;
-
-s a[129];
-s* b = a;
-
-void f(unsigned char i)
-{
- printf("%d %d (should be 23 42)\n", b[i].a, b[i].b);
-}
-
-
-int main(void)
-{
- b[128].a = 23;
- b[128].b = 42;
- f(128);
-}
+++ /dev/null
-/*$ -fno-if-conv -fno-inline $*/
-
-#include <stdio.h>
-#include <stdlib.h>
-
-int a = 42;
-
-int changea(void) {
- a = 13;
- return 1;
-}
-
-int f2(void) {
- int t = a;
- int t2 = changea();
- int t3 = t + t2;
- return t3;
-}
-
-int f3(int arg) {
- int t = a + arg;
- changea();
- return t;
-}
-
-int f(int f) {
- int t = a;
- changea();
-
- /* must not use source address mode (loading from a) for t+1 */
- if(f > 10000) {
- return t + 1;
- }
- return f + 2;
-}
-
-int main(void) {
- srand(0);
- printf("Res: %d (should be 43)\n", f(1000000));
- a = 42;
- printf("Res2: %d (should be 43)\n", f2());
- return 0;
-}
+++ /dev/null
-/*$ -fno-inline $*/
-#include <stdio.h>
-
-unsigned f(unsigned a, unsigned b)
-{
- return (long long)a * b >> 16;
-}
-
-
-int main(void)
-{
- printf("%X\n", f(0xFFFFFFFF, 1));
- return 0;
-}
+++ /dev/null
-
-float f(float a, float b) {
- return a*a + b*b;
-}
-
-int fi(int a, int b) {
- return a*a + b*b;
-}
-
-int main(void) {
- float a = 3;
- float b = 4;
- float c = 5;
- printf("%.30f %.30f %.30f %.30f %.30f\n", a, b, c, f(a, b), c*c);
- printf("%d\n", fi(3, 4));
- return 0;
-}
+++ /dev/null
-/*$ -std=c99 $*/
-
-#include <stdio.h>
-#include <math.h>
-
-int main() {
- float x = NAN;
- double y = x;
-
- printf("%f\n", y);
- return 0;
-}
+++ /dev/null
-/*$ -fno-inline -fno-if-conv $*/
-
-long long k(long long a)
-{
- return a < 0 ? -a : a;
-}
-
-int main(void)
-{
- printf("%lld\n", k(0x80000000LL));
- return 0;
-}
+++ /dev/null
-int main(void)
-{
- float f = 1223432e3;
- long l = f;
- printf("long %ld float %f\n", l, f);
- return 0;
-}
+++ /dev/null
-unsigned char k;
-
-int main(void) {
- /* should result in a decb k x86 instruction */
- --k;
- return 0;
-}
+++ /dev/null
-/*$ -fno-inline $*/
-#include <stdio.h>
-
-int k;
-
-int f(int a)
-{
- if(k < 20) {
- rand();
- return a < 5 ? 10 : 20;
- } else {
- return a < 5 ? 20 : 0;
- }
-}
-
-int main(void)
-{
- k = 21;
- printf("Res: %d should be 0\n", f(20));
- return 0;
-}
+++ /dev/null
-/*$ -fno-inline -fno-cond-eval $*/
-
-int x;
-
-int destroy_flags(void) {
- rand();
- return 0;
-}
-
-int f(void) {
- int a = (x < 5);
- int t = 1;
- destroy_flags();
- if(a) {
- t = 42;
- }
- return t;
-}
-
-int main(void) {
- x = 2;
- printf("Res: %d (expected 42)\n", f());
- x = 10;
- printf("Res: %d (expected 1)\n", f());
-
- return 0;
-}
+++ /dev/null
-/*$ -fno-inline $*/
-
-#include <stdio.h>
-#include <limits.h>
-
-int f(unsigned x) {
- return x < 10;
-}
-
-int main(void) {
- printf("Res: %d (should be 0)\n", f(INT_MIN));
- return 0;
-}
+++ /dev/null
-/*$ -fno-inline */
-#include <stdio.h>
-
-void test1(int a) {
- switch (a) {
- case 1:
- goto label;
- default:
- printf("default\n");
- break;
- label:
- printf("case 1\n");
- }
-}
-
-void test2(int a) {
- switch (a) case 1: printf("case 1\n");
- printf("end\n");
-}
-
-int main() {
- test1(1);
- test1(2);
- test2(1);
- test2(2);
- return 0;
-}
+++ /dev/null
-/*$ -fno-inline -bra-chordal-co-algo=heur4 -blistsched-select=heur */
-
-/* demonstrates copyheur4 violating register constraints of FucomFnstsw */
-#include <stdio.h>
-
-void f(float g, float g2) {
- if(g < 1.23) {
- if(g2 < 20)
- printf("good");
- } else {
- if(g2 < 20)
- printf("bad");
- }
-}
-
-int main(void)
-{
- f(0.5, 10);
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-/* produces a graph with wrong modes */
-
-static char parens[] = "=!<,>";
-static char *p = & parens[2];
-
-int f(void)
-{
- return (p - parens) % 2 ? 42 : 13;
-}
-
-int main(void)
-{
- printf("Res: %d (should be 13)\n", f());
- return 0;
-}
+++ /dev/null
-/* frontend fails with empty switch */
-
-int main(int argc, char **argv)
-{
- switch(argc) {
- }
- return 0;
-}
+++ /dev/null
-typedef struct TypeToken {
- unsigned int handle;
- unsigned short DbId;
- unsigned short CoreDbId;
-} TokenType;
-
-extern TokenType NullToken;
-TokenType NullToken = {0, 0, 0};
-
-int main(int argc, char **argv)
-{
- TokenType t = NullToken;
-
- return t.handle;
-}
+++ /dev/null
-int w[] = { 1, 2, 3 };
-int *x = w;
-
-int f(long long a)
-{
- return x[a];
-}
-
-int main(void)
-{
- printf("%d (should be 2)\n", f(1));
- return 0;
-}
+++ /dev/null
-/* there's no 64bit fst without pop */
-
-double z = 0.0;
-unsigned int x;
-double y;
-
-int main(void) {
- x = z;
- y = z;
-
- return x;
-}
+++ /dev/null
-/*$ -fno-inline $*/
-
-int test(unsigned int a)
-{
- return a > 0;
-}
-
-int main(void)
-{
- printf("0xFFFFFFFFU > 0 is %d (should be 1)\n", test(0xFFFFFFFFU));
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-unsigned long long x = 43;
-
-int main(void) {
- printf("Res: %lld (should be 42)\n", x - 1);
- return 0;
-}
+++ /dev/null
-unsigned int x = 12345;
-
-int main(int argc, char **argv)
-{
- unsigned short k = ~x;
- char b1 = k & 0xff;
- char b2 = k >> 8;
-
- printf("%d %d\n", b1, b2);
- return 0;
-}
+++ /dev/null
-/*$ -fdeconv $*/
-/* frontend sometimes produces 16bit operations which the backend can't handle
- * correctly (yet)
- */
-#include <stdio.h>
-
-unsigned int k = 1;
-
-int main(void)
-{
- unsigned short x = k;
-
- x += 0xffff;
- x >>= 15;
- if(x == 0) {
- printf("ok\n");
- return 0;
- } else {
- printf("bad\n");
- return 1;
- }
-}
+++ /dev/null
-/* fehler92: localopt messing up const/tarval modes */
-#include <stdio.h>
-
-int main(int argc, char **argv)
-{
- unsigned int x;
- int y = 3;
-
- if(argc > 1) {
- rand();
- x = 20;
- } else {
- x = 10;
- }
- y <<= x;
-
- printf("Res: %d\n", y);
- return 0;
-}
+++ /dev/null
-typedef struct K K;
-struct K {
- int dummy;
- int high;
- int low;
-};
-
-K v = { 0, 0, -1 };
-K c = { 0, 0, 4 };
-
-#define H(A) (A)->high
-#define L(A) (A)->low
-
-#define LTU(A, B) \
- (((unsigned) H(A) < (unsigned) H(B)) || (((unsigned) H(A) == (unsigned) (H(B))) && ((unsigned) L(A) < (unsigned) L(B))))
-
-K *p_v = &v;
-K *p_c = &c;
-
-int main(void) {
- K* pv = p_v;
- K* pc = p_c;
- int res;
-
- res = LTU(pv,pc);
-
- printf("Res: %d (should be 0)\n", res);
- return 0;
-}
+++ /dev/null
-/*$ -fno-inline $*/
-#include <stdio.h>
-
-struct decompostition {
- int a, b;
-};
-
-static struct decompostition do_something(void)
-{
- struct decompostition c;
- rand();
- return c;
-}
-
-int main(void) {
- int arr[5];
- struct decompostition dc;
-
- arr[0] = 123;
- arr[1] = 245;
- dc = do_something();
- printf("%d %d\n", arr[0], arr[1]);
-
- return 0;
-}
+++ /dev/null
-#define SIZE 268435456
-char too_long_for_firm[SIZE];
-
-int main(int argc, char **argv)
-{
- too_long_for_firm[SIZE-1] = '\0';
- return 0;
-}
+++ /dev/null
-int shrs1(unsigned x) {
- return -(x >> 31);
-}
-
-int shr1(int x) {
- return -(x >> 31);
-}
-
-int main(void)
-{
- printf("%d (should be -1)\n", shrs1(-3));
- printf("%d (should be 1)\n", shr1(-3));
- printf("%d (should be 0)\n", shrs1(3));
- printf("%d (should be 0)\n", shr1(3));
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-unsigned MediumSize = 4096;
-unsigned ObjSize = 136;
-unsigned RgnEntrys = 30;
-unsigned AllocEntrys = 26000;
-//unsigned RgnEntrys = 30;
-//unsigned AllocRgns = 866;
-
-int main(void)
-{
- unsigned RgnEntrys = MediumSize / ObjSize;
- unsigned AllocRgns = AllocEntrys / RgnEntrys;
-
- printf("Red. %u %u\n", RgnEntrys, AllocRgns);
- return 0;
-}
+++ /dev/null
-char str[42];
-
-int test(void)
-{
- return str != 0;
-}
-
-int main(void)
-{
- printf("%d (should be 1)\n", test());
- return 0;
-}
+++ /dev/null
-int c = 16;
-
-unsigned long long test(int c)
-{
- return 0xFFFFFFFFFFFFFFFFULL >> c;
-}
-
-int main(void)
-{
- printf("0x%016llX (should be 0x0000FFFFFFFFFFFF)\n", test(c));
- return 0;
-}
+++ /dev/null
-/* test for the spiller */
-int incs[14];
-
-void simpleSort ( int lo, int hi, int d )
-{
- int i, j, h, bigN, hp;
- int v;
-
- for (; hp >= 0; hp--) {
- h = incs[hp];
- if (hp >= 5)
- putchar(lo);
-
- i = lo + h;
- while (1) {
- if (i > hi) break;
- j = i;
- while (putchar(d)) {
- j = j - h;
- }
- }
- }
-}
-
-int main(void) {
- return 0;
-}
+++ /dev/null
-long double l;
-
-int main(void) {
- l = l + 1.0;
- printf("%llf\n", l);
- return 0;
-}
+++ /dev/null
-/*$ -fdeconv -fif-conv $*/
-
-char abs_Bs(char x)
-{
- if (x < 0) x *= -1;
- return x;
-}
-
-char c = -23;
-
-int main(void)
-{
- printf("%d\n", abs_Bs(c));
-}
+++ /dev/null
-unsigned long long test_shld(unsigned x)
-{
- return ((unsigned long long)x << 32 | x) << x;
-}
-
-int main(void)
-{
- return 0;
-}
+++ /dev/null
-#include "dumpmem.h"
-
-struct Bla {
- char a : 2;
- short b : 15;
- int c : 1;
-};
-
-struct Bla b = { 0, -1, 0 };
-
-int main(void)
-{
- dumpMem(&b, sizeof(struct Bla));
- printf("Sizeof %d\n", sizeof(struct Bla));
- printf("Vals: %d %d %d\n", b.a, b.b, b.c);
- return 0;
-}
+++ /dev/null
-/* frontend crashs on missing return in compound returning function */
-struct A {
- int a, b;
-};
-
-struct A func(void)
-{
-}
-
-int main(void)
-{
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-long long k = 0x100000000LL;
-
-double f(void) {
- return k;
-}
-
-int main(void) {
- printf("Res: %f\n", f());
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-double k = 4294967296.000000;
-
-long long f(void) {
- return k;
-}
-
-int main(void) {
- printf("Res: %llx\n", f());
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-int f(void) {
- return 42;
-}
-
-int (*f_ptr) (void) = &f;
-
-int main(void) {
- (**printf)("Res: %d (should be 42)\n", (********f_ptr)());
- return 0;
-}
+++ /dev/null
-int puts(const char *str);
-
-void p(void)
-{
- puts("p");
-}
-
-void q(void)
-{
- puts("q");
-}
-
-void f(int x, long long y) {
- if (x) {
- if (y)
- p();
- if(!y)
- q();
- } else {
- if (y)
- q();
- if(!y)
- p();
- }
-}
-
-int main(void)
-{
- f(40, 4);
- f(0, 1);
- f(0, 0);
- f(41, 0);
- return 0;
-}
+++ /dev/null
-struct A {
- int a, b, c;
-};
-
-struct A globa = { 1, 2, 3 };
-
-struct A funk(void) {
- struct A res;
-
- res.a = globa.c + 20;
- res.b = globa.b + 20;
- res.c = globa.a + 20;
-
- return res;
-}
-
-struct A funk2(void) {
- struct A res;
-
- memcpy(&res, &globa, sizeof(res));
-
- res.a -= 20;
- res.b -= 20;
- res.c -= 20;
-
- return res;
-}
-
-int main(void) {
- globa = funk();
- printf("%d %d %d\n", globa.a, globa.b, globa.c);
- globa = funk2();
- printf("%d %d %d\n", globa.a, globa.b, globa.c);
- return 0;
-}
+++ /dev/null
-int x = 0;
-
-int main(int argc, char *argv[]) {
- int y;
- char *p = &x;
-
- *p = 23;
- y = x;
- x = 35;
- return y != 23;
-}
+++ /dev/null
-int FirstOne(long long arg1)
-{
- union doub {
- unsigned short i[4];
- long long d;
- };
-
- union doub x;
- x.d = arg1;
- return x.i[2];
-}
-
-int main(void)
-{
- return FirstOne(0);
-}
+++ /dev/null
-#ifndef CHAR_BIT
-#define CHAR_BIT 8
-#endif
-
-#define ROL(a,b) (((a) << (b)) | ((a) >> ((sizeof (a) * CHAR_BIT) - (b))))
-#define ROL(a,b) (((a) << (b)) | ((a) >> ((sizeof (a) * CHAR_BIT) - (b))))
-
-/* This is NOT folded into a ROL, but demonstrates an error in old lowering */
-long long testLL(long long a) {
- return ROL(a,3);
-}
-
-int main() {
- int printf(const char *fmt, ...);
-
- printf("%lld\n", testLL(1));
- return 0;
-}
+++ /dev/null
-unsigned x = 0xAABBCCDD;
-unsigned y = 15;
-unsigned z = 12;
-
-int main(void) {
- unsigned t = x;
- unsigned t2 = y;
- unsigned l = z;
- printf("%X\n", (t << t2) | (t >> (32 - l)));
- return 0;
-}
+++ /dev/null
-int test(float x, double y) {
- return x + y;
-}
-
-int main() {
- printf("%d (expected 15)\n", test(7.753f, 8.222));
- return 0;
-}
+++ /dev/null
-int main(void) {
- float fy=3;
- int c = 7 * fy;
-
- printf("21 == %d \n", c);
- return 0;
-}
+++ /dev/null
-double x = 4294967295.0;
-
-int main(void) {
- printf("%u (should be 4294967295)\n", (unsigned int)x);
- return 0;
-}
+++ /dev/null
-/*$ -fcombo $*/
-#include <stdlib.h>
-
-char *test(char *name) {
- char *p, *trunc = NULL;
- int plen;
- int min_part = 3;
- do {
- p = name;
- while (*p) {
- plen = 3;
- p += plen;
- if (plen > min_part) trunc = p-1;
- }
- } while (trunc == NULL && --min_part != 0);
- return p;
-}
-
-int main() {
- return 0;
-}
+++ /dev/null
-/*$ -std=c99 $*/
-int f(int x)
-{
- return sizeof(char*[x]);
-}
-
-int main(void)
-{
- return f(23) != sizeof(char*) * 23;
-}
+++ /dev/null
-/*$ -fno-inline $*/
-
-int f(float x)
-{
- return 1 << (int)x;
-}
-
-int main(void)
-{
- return f(3.0) != 8;
-}
+++ /dev/null
-int main(int argc, char *argv[])
-{
- switch(argc)
- {
- case 0x666d7420: // 'fmt '
- return 1;
- case 0x4c495354: // 'LIST'
- return 2;
- default:
- break;
- }
- return 0;
-}
+++ /dev/null
-/*$ -fcombo $*/
-int *zptr;
-
-#define swap(lv1, lv2) \
- { int tmp = lv1; lv1 = lv2; lv2 = tmp; }
-
-void vswap ( int p1, int p2, int n )
-{
- while (n > 0) {
- swap(zptr[p1], zptr[p2]);
- p1++; p2++; n--;
- }
-}
-
-int main() {
- return 0;
-}
+++ /dev/null
-int x = 23;
-
-int main(void)
-{
- int a = x + 19;
- double b = a;
- x = b;
- printf("%d\n", x);
- return 0;
-}
+++ /dev/null
-int x = 0x5FFFFFFF;
-
-int main(void)
-{
- double a = x;
- float b = a;
- double c = b;
- x = c;
- printf("%f %f %f %d\n", a, b, c, x);
- return 0;
-}
+++ /dev/null
-asm(
- "bla:\n"
- ".long 0"
-);
-extern int bla;
-int main()
-{
- return bla;
-}
+++ /dev/null
-int x;
-
-int
-main ()
-{
- if (x) {
- struct s { int j; };
- struct s *b; b->j = 5;
- }
-
- return 0;
-}
+++ /dev/null
-int main()
-{
- if (0) {
- long (*foo) (long, long) = __builtin_expect;
- }
- return 0;
-}
+++ /dev/null
-/*$ -march=i686 $*/
-
-double __attribute__((__cdecl__)) atof (const char *__nptr);
-
-int a;
-char *str;
-
-void GIB_Range_f (void)
-{
- double i, inc = 9, limit = 42;
- if (a == 4) {
- inc = atof(str);
- if(inc == 0) return;
- }
- for (i = atof (str); inc < 0 ? i >= limit : i <= limit; i += inc) {
- }
-}
-
-int main(void)
-{
- return 0;
-}
+++ /dev/null
-char x;
-char *p = &x;
-int y = 0;
-
-int main(void) {
- return (&x) - (p - y);
-}
+++ /dev/null
-/*$ -fcombo $*/
-static int bi_valid;
-static int bi_buf = 0;
-
-int outbuf;
-
-#define Buf_size (8 * 2*sizeof(char))
-
-#define put_byte(c) {outbuf=(unsigned char)(c); }
-
-#define put_short(w) \
-{ if (outcnt > 0) { \
- outbuf = (unsigned char) (w); \
- }\
-}
-
-void send_bits(int value) {
- if (bi_valid > 0) {
- bi_buf |= bi_valid;
- if (outbuf > 0) {
- outbuf = bi_buf;
- }
- bi_buf = value;
- }
-}
-
-int main() {
- return 0;
-}
+++ /dev/null
-void* p;
-
-int main(void)
-{
- return p + 1 == p;
-}
+++ /dev/null
-unsigned long long f(void)
-{
- unsigned long long res;
- asm(
- "mul %2\n\t"
- : "=A" (res)
- : "a" (0x10000), "r" (0x10000)
- );
- return res;
-}
-
-int main(void)
-{
- printf("0x%llX\n", f());
- return 0;
-}
+++ /dev/null
-int main(void)
-{
- int x = 19;
- asm("addl $23, %0" : "+r" (x));
- printf("%d\n", x);
- return x != 42;
-}
+++ /dev/null
-int main(void)
-{
- int x = 1;
- asm("movl $0, %0" : "=m" (x));
- return x;
-}
+++ /dev/null
-/*$ -fcombo $*/
-
-int test() {
- int i, j;
-
- for (i = 0, j = 0; i < 5; ++i, ++j);
-
- while (i == j) {
- /* endless */
- }
- return i;
-}
-
-int main() {
- return 0;
-}
+++ /dev/null
-struct X
-{
- int x;
-};
-
-extern const struct X bla;
-
-struct X const* const blub[] = { &bla };
-
-struct X const bla = { 23 };
-
-int main(void)
-{
- return 0;
-}
+++ /dev/null
-long double ld = 1;
-
-int main(void)
-{
- printf("%Lf (1.000000)\n", ld);
- return 0;
-}
+++ /dev/null
-long long a;
-long long b;
-
-long long f(void)
-{
- return a - b;
-}
-
-int main(void)
-{
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-long long test(long long *i, int *p) {
- long long v = *i + (*p != 0);
- return v;
-}
-
-int main() {
- long long x = 0xFFFFFFFF;
- int i = 5;
- printf("%llx\n", test(&x, &i));
- return 0;
-}
+++ /dev/null
-/*$ -fgvn-pre -fno-gcse $*/
-char arr[256];
-char X;
-
-int test(int x, int p) {
- int y = 0;
- if (x) {
- y = 1;
- }
- do {
- ++y;
- X = arr[y];
- } while (p);
-}
-
-int main() {
- return 0;
-}
+++ /dev/null
-/*$ -fgvn-pre -fno-gcse $*/
-int bl_count[256];
-
-int test(int max_length, int overflow) {
- int bits;
-
- do {
- bits = max_length-1;
- while (bl_count[bits] == 0) bits--;
- bl_count[bits]--; /* move one leaf down the tree */
- bl_count[bits+1] += 2; /* move one overflow item as its brother */
- } while (overflow > 0);
- return 0;
-}
-
-int main() {
- return 0;
-}
+++ /dev/null
-float foo(float zNear, float zFar)
-{
- float depth = zFar - zNear;
-
- return -2 * zFar * zNear / depth;
-}
-
-int main(void) {
- return foo(4, 2048) >= 0;
-}
+++ /dev/null
-#include <assert.h>
-#include <signal.h>
-#include <unistd.h>
-
-void f(int x)
-{
- assert(x < 0);
-}
-
-void handler(int sig)
-{
- (void)sig;
- _exit(0);
-}
-
-int main(void)
-{
- signal(SIGABRT, handler);
- f(1);
- return 1;
-}
+++ /dev/null
-int x=42,y=42;
-
-int main(void) {
- int ret = x & y ? 0:1;
- printf("%d\n", ret);
- return ret;
-}
+++ /dev/null
-#define INT_TO_FLOAT(I) ((2.0F * (I) + 1.0F) * (1.0F/4294967294.0F))
-
-float A, B, C;
-
-void f(float r, float g, float b) {
- A = r; B = g; C = b;
-}
-
-void bla(int r, int g, int b) {
- f(INT_TO_FLOAT(r), INT_TO_FLOAT(g), INT_TO_FLOAT(b));
-}
-
-int main(int argc, char *argv[]) {
- return 0;
-}
+++ /dev/null
-int *p;
-
-int main(int argc, char **argv) {
- return 0;
-}
-
-int f(int a) {
- return p[a];
-}
+++ /dev/null
-float g = 0.098;
-
-#define myftol(x) ((int)(x))
-
-void foo(unsigned char *colors) {
- int v;
- float glow = g;
-
- v = myftol(255*glow);
- colors[0] = colors[1] = colors[2] = v;
-}
-
-int main(void) {
- unsigned char colors[3];
- foo(colors);
- printf("%d %d %d\n", colors[0], colors[1], colors[2]);
- return 0;
-}
+++ /dev/null
-#define NE 6
-
-/* Number of 16 bit words in internal format */
-#define NI (NE+3)
-
-/* Array offset to exponent */
-#define E 1
-
-/* Array offset to high guard word */
-#define M 2
-
-
-static void
-eshdn1 (x)
- register unsigned short *x;
-{
- register unsigned short bits;
- int i;
-
- x += M; /* point to significand area */
-
- bits = 0;
- for (i = M; i < NI; i++)
- {
- if (*x & 1)
- bits |= 1;
- *x >>= 1;
- if (bits & 2)
- *x |= 0x8000;
- bits <<= 1;
- ++x;
- }
-
-}
-
-static int
-edivm (den, num)
- unsigned short den[], num[];
-{
- eshdn1 (num);
-}
-
-int main(int argc, char *argv[]) {
- unsigned short den[NI], num[NI];
-
- edivm(den, num);
- return 0;
-}
+++ /dev/null
-unsigned short tdenm = 0xff;
-unsigned int ui = 0xffffffff;
-
-int test(void) {
-
- unsigned int tnum = ui;
-
- /* Do not execute the divide instruction if it will overflow. */
- if ((tdenm * 0xffffL) < tnum)
- return 0;
- return 1;
-}
-
-int main(int argc, char *argv[]) {
- return test();
-}
+++ /dev/null
-/*$ -fgvn-pre -fno-gcse $*/
-
-#define MAX_SPEC_FD 3
-struct spec_fd_t {
- int limit;
- int len;
- int pos;
- unsigned char *buf;
-} spec_fd[MAX_SPEC_FD];
-
-int spec_load (int num, int size) {
- spec_fd[num].len = 0;
- while (spec_fd[num].len < size) {
- int tmp = size - spec_fd[num].len;
- if (tmp > spec_fd[num].len) tmp = spec_fd[num].len;
- spec_fd[num].len += tmp;
- }
- return 0;
-}
-
-int main(int argc, char *argv[]) {
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-#include <stdlib.h>
-#include <signal.h>
-
-int test(void) {
- abort();
-
- for(;;);
-}
-
-void handler(int sig)
-{
- printf(sig == SIGABRT ? "ok\n" : "fail");
- fflush(stdout);
- exit(sig != SIGABRT);
-}
-
-int main(int argc, char *argv[]) {
- alarm(1);
- signal(SIGABRT, handler);
- signal(SIGALRM, handler);
- test();
- return 1;
-}
+++ /dev/null
-#include <stdio.h>
-#include <stdlib.h>
-#include <signal.h>
-
-volatile int x = 2;
-
-int test(void) {
-
- x = 3;
-
- for(;;);
-}
-
-void handler(int sig)
-{
- printf(x == 3 ? "ok\n" : "fail");
- fflush(stdout);
- exit(x != 3);
-}
-
-int main(int argc, char *argv[]) {
- signal(SIGALRM, handler);
- alarm(1);
- test();
- printf("FAIL ENDLESS LOOP\n");
- return 1;
-}
+++ /dev/null
-#include <stdio.h>
-#include <stdlib.h>
-#include <signal.h>
-
-volatile int x = 2;
-volatile int y;
-
-int test(void) {
-
- x = 3;
- y = 4;
-
- for(;;) {
- x = y;
- }
-}
-
-void handler(int sig)
-{
- printf(x == 4 ? "ok\n" : "fail");
- fflush(stdout);
- exit(x != 4);
-}
-
-int main(int argc, char *argv[]) {
- alarm(1);
- signal(SIGALRM, handler);
- test();
- printf("FAIL ENDLESS LOOP\n");
- return 1;
-}
+++ /dev/null
-#include <stdio.h>
-#include <signal.h>
-#include <stdlib.h>
-#include <unistd.h>
-
-int foo(int x)
-{
- while(x == 0)
- ;
-
- return x;
-}
-
-int k;
-
-void handler(int sig)
-{
- printf("ok\n");
- _exit(0);
-}
-
-int main(void) {
- signal(SIGALRM, handler);
- alarm(1);
-
- foo(0);
-
- printf("endless loop returned!\n");
- return 1;
-}
+++ /dev/null
-struct {
- int x;
- int lets[3008];
-} glob;
-
-int x = 42;
-
-int main(void) {
- int y = glob.lets[5] + glob.lets[x * 3];
- return y;
-}
+++ /dev/null
-/*$ -fomit-frame-pointer $*/
-
-#include <stdio.h>
-
-
-unsigned __attribute__((noinline)) get_sp(void)
-{
- unsigned esp;
- asm("mov %%esp, %0": "=r" (esp));
- return esp;
-}
-
-
-int main(void)
-{
-#ifndef __INTEL_COMPILER // ICC does not align the stack
- unsigned sp = get_sp();
- if (sp % 16 != 12) {
- printf("stack is unaligned after call: 0x%X\n", sp);
- return 1;
- }
-#endif
- return 0;
-}
+++ /dev/null
-long long f(unsigned x, unsigned y)
-{
- return (long long)x * y >> 32;
-}
-
-int main(void)
-{
- return 0;
-}
+++ /dev/null
-/*$ -fconfirm -fcond-eval $*/
-
-int test(int lnWrd, int *ptExp) {
- int idx = 0;
-
- while ( lnWrd > 0 ) {
- if ( *ptExp ) {
- *ptExp = 0;
- lnWrd--;
- }
- idx++;
- ptExp++;
- }
- return idx;
-}
-
-int arr[] = { 1, 0, 0, 0, 2, 3, 4};
-
-int main(int argc, char *argv[]) {
- int x = test(3, arr);
- printf("%d\n", x);
- return 0;
-}
+++ /dev/null
-/*$ -fgvn-pre -fno-gcse $*/
-
-int test() {
- int i;
- char inUse16[16];
-
- i = 0;
- do {
- if (rand() == 1)
- inUse16[i] = 1;
- else
- inUse16[i] = 0;
- ++i;
- } while (i < 16);
-
- return inUse16[0];
-}
-
-int main(void)
-{
- return 0;
-}
+++ /dev/null
-/*$ -O4 -march=core2 $*/
-#include <alloca.h>
-
-extern void puts(const char *text);
-
-void test (void)
-{
- char *temp = (char *) alloca (16);
- puts(temp);
-}
-
-int main(int argc, char *argv[]) {
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-unsigned fib(unsigned n)
-{
- if(n == 0) {
- return 0;
- }
- if(n == 1) {
- return 1;
- }
-
- return fib(n-1) + fib(n-2);
-}
-
-int main(int argc, char** argv) {
- unsigned n = 8;
- if(argc > 1)
- n = (unsigned) atoi(argv[1]);
-
-#ifdef COUNT_BRANCHES
- b1 = b2 = b3 = 0;
-#endif
- printf("Fib %u: %u\n", n, fib(n));
-#ifdef COUNT_BRANCHES
- printf("Branches: 1:%d 2:%d 3:%d\n", b1, b2, b3);
-#endif
-
- return 0;
-}
+++ /dev/null
-unsigned long fib_iter(int n) {
- unsigned long a = 1, b = 1, c = 0, i;
-
- if (n < 2)
- return 1;
-
- for (i = 1; i < n; i++) {
- c = a + b;
- a = b;
- b = c;
- }
-
- return c;
-}
-
-int main(int argc, char *argv[]) {
- int i, n = 10;
-
- if (argc > 1) {
- n = atoi(argv[1]);
- }
-
- for (i = 0; i <= n; i++)
- printf("fib(%d) = %lu\n", i, fib_iter(i));
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-int test(double f) {
- return f;
-}
-
-int arraycopy(double *p, int *q) {
- double sum = 0.0;
- int i;
-
- for (i = 0; i < 10; ++i) {
- double v = p[i];
- q[i] = v;
- sum += v;
- }
- return sum;
-}
-
-static double data[10] = {
- -1.0, +1.0, 1/100.0, -1/100.0, 439023402304342343.0, 30303.0, 0.0
-};
-
-int main() {
- int res[10], i;
-
- arraycopy(data, res);
- for (i = 0; i < 10; ++i) {
- printf("%f -> %d\n", data[i], res[i]);
- }
-
- printf("%d\n", test(45.0));
- return 0;
-}
+++ /dev/null
-/*$ -std=c99 $*/
-
-#include <stdio.h>
-#include <math.h>
-
-#define test(type, name, op) \
-static void test_##type##_##name(type a, type b) { \
- if (a op b) \
- printf("%f " #op " %f = true\n", a, b); \
- else \
- printf("%f " #op " %f = false\n", a, b); \
-}
-
-#define testu(type, op) \
-static void test_##type##_##op(type a, type b) { \
- if (op(a,b)) \
- printf(#op "(%f, %f) = true\n", a, b); \
- else \
- printf(#op "(%f, %f) = false\n", a, b); \
-}
-
-#define testnu(type, op) \
-static void test_##type##_not##op(type a, type b) { \
- if (!op(a,b)) \
- printf("!" #op "(%f, %f) = true\n", a, b); \
- else \
- printf("!" #op "(%f, %f) = false\n", a, b); \
-}
-
-test(float, l, <)
-test(float, le, <=)
-test(float, eq, ==)
-test(float, ge, >=)
-test(float, g, >)
-test(float, lg, !=)
-
-testu(float, isgreater)
-testu(float, isgreaterequal)
-testu(float, isless)
-testu(float, islessequal)
-testu(float, islessgreater)
-testu(float, isunordered)
-
-testnu(float, isgreater)
-testnu(float, isgreaterequal)
-testnu(float, isless)
-testnu(float, islessequal)
-testnu(float, islessgreater)
-testnu(float, isunordered)
-
-/*-------------------------- */
-test(double, l, <)
-test(double, le, <=)
-test(double, eq, ==)
-test(double, ge, >=)
-test(double, g, >)
-test(double, lg, !=)
-
-testu(double, isgreater)
-testu(double, isgreaterequal)
-testu(double, isless)
-testu(double, islessequal)
-testu(double, islessgreater)
-testu(double, isunordered)
-
-testnu(double, isgreater)
-testnu(double, isgreaterequal)
-testnu(double, isless)
-testnu(double, islessequal)
-testnu(double, islessgreater)
-testnu(double, isunordered)
-
-#undef test
-
-double dA = 3.0, dB = 4.0, dNan = NAN;
-float fA = 3.0, fB = 4.0, fNan = NAN;
-
-int main() {
-#define test(type, name, a, b) test_##type##_##name(a,b)
-
- test(float, l, fA, fB);
- test(float, le, fA, fB);
- test(float, eq, fA, fB);
- test(float, ge, fA, fB);
- test(float, g, fA, fB);
- test(float, lg, fA, fB);
- test(float, l, fA, fNan);
- test(float, le, fA, fNan);
- test(float, eq, fA, fNan);
- test(float, ge, fA, fNan);
- test(float, g, fA, fNan);
- test(float, lg, fA, fNan);
- test(float, lg, fNan, fNan);
-
- test(float, isgreater, fA, fB);
- test(float, isgreaterequal, fA, fB);
- test(float, isless, fA, fB);
- test(float, islessequal, fA, fB);
- test(float, islessgreater, fA, fB);
- test(float, isunordered, fA, fB);
- test(float, isgreater, fA, fNan);
- test(float, isgreaterequal, fA, fNan);
- test(float, isless, fA, fNan);
- test(float, islessequal, fA, fNan);
- test(float, islessgreater, fA, fNan);
- test(float, isunordered, fA, fNan);
- test(double, islessgreater, fA, fB);
- test(float, islessgreater, fNan, fNan);
-
- test(float, notisgreater, fA, fNan);
- test(float, notisgreaterequal, fA, fNan);
- test(float, notisless, fA, fNan);
- test(float, notislessequal, fA, fNan);
- test(float, notislessgreater, fA, fNan);
- test(float, notisunordered, fA, fNan);
-
- test(double, l, dA, dB);
- test(double, le, dA, dB);
- test(double, eq, dA, dB);
- test(double, ge, dA, dB);
- test(double, g, dA, dB);
- test(double, lg, dA, dB);
- test(double, l, dA, dNan);
- test(double, le, dA, dNan);
- test(double, eq, dA, dNan);
- test(double, ge, dA, dNan);
- test(double, g, dA, dNan);
- test(double, lg, dA, dNan);
- test(double, lg, dNan, dNan);
-
- test(double, isgreater, dA, dB);
- test(double, isgreaterequal, dA, dB);
- test(double, isless, dA, dB);
- test(double, islessequal, dA, dB);
- test(double, islessgreater, dA, dB);
- test(double, isunordered, dA, dB);
- test(double, isgreater, dA, dNan);
- test(double, isgreaterequal, dA, dNan);
- test(double, isless, dA, dNan);
- test(double, islessequal, dA, dNan);
- test(double, islessgreater, dA, dNan);
- test(double, isunordered, dA, dNan);
- test(double, islessgreater, dA, dB);
- test(double, islessgreater, dNan, dNan);
-
- test(double, notisgreater, dA, dNan);
- test(double, notisgreaterequal, dA, dNan);
- test(double, notisless, dA, dNan);
- test(double, notislessequal, dA, dNan);
- test(double, notislessgreater, dA, dNan);
- test(double, notisunordered, dA, dNan);
-}
+++ /dev/null
-#include <stdio.h>
-
-void mymain(int argc, const char * const*argv) {
- printf("A0: %s AC: %d\n", argv[0], argc);
-}
-
-int main(argc, argv)
- int argc;
- char **argv;
-{
- const char *args[] = { "blup", "bla" };
-
- mymain(2, args);
- return 0;
-}
+++ /dev/null
-int main() {
- printf("My __func__ name is %s\n", __func__);
- printf("My __FUNCTION__name is %s\n", __FUNCTION__);
- printf("My __PRETTY_FUNCTION__name is %s\n", __PRETTY_FUNCTION__);
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-int gcd(int a, int b)
-{
- int i = 0;
-
- while(a != b)
- {
- if(a > b) {
- a = a - b;
- }
- else {
- b = b - a;
- }
- ++i;
- }
- return a;
-}
-
-int main(int argc, char** argv)
-{
- int a = 49, b = 35, i, g = 0;
-
- if(argc > 2) {
- a = atoi(argv[1]);
- b = atoi(argv[2]);
- }
-
- printf("gcd.c\n");
-
- for (i = 0; i < 100000; i++) {
- g = gcd(a, b);
- }
-
- printf(" GCD of %d and %d is %d\n", a, b, g);
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-#include <limits.h>
-#include <assert.h>
-
-int gcd(int a, int b)
-{
- int i = 0;
-
- while(a != b)
- {
- if(a > b) {
- a = a - b;
- }
- else {
- b = b - a;
- }
- ++i;
- }
- return a;
-}
-
-void gcd_no_out(int numruns) {
- int i, j;
-
- for (i = 1; i < numruns; i++) {
- for (j = 1; j < numruns; j++) {
- gcd(i, j);
- }
- }
-}
-
-void gcd_out(int numruns) {
- int i, j;
-
- for (i = 1; i < numruns; i++) {
- for (j = 1; j < numruns; j++) {
- printf("gcd(%d, %d) = %d\n", i, j, gcd(i, j));
- }
- }
-}
-
-int main(int argc, char **argv)
-{
- printf("gcd.c\n");
-
- if (argc == 1) {
- gcd_out(10);
- }
- else {
- int numruns = 1000;
- numruns = atoi(argv[1]);
- gcd_out(numruns);
- }
-
- return 0;
-}
+++ /dev/null
-static void f1(void) {
- printf("f1\n");
-}
-
-static void f2(void) {
- printf("f2\n");
-}
-
-int test(char *x)
-{
- char ret = *x;
-
- if (x)
- f1();
- else
- f2();
- return ret;
-}
-
-int main(int argc, char *argv[]) {
- char x = '\0';
-
- return test(&x);
-}
+++ /dev/null
-/* globalrefs.c - Test symbolic constant expressions constructed from
- * global addresses and index expressions into global addresses.
- * Do this both with global constants and with inline constant.
- * Instead of printing absolute addresses, print out the differences in
- * memory addresses to get output that matches that of the native compiler.
- */
-
-#include <stdio.h>
-
-#define __STDC_LIMIT_MACROS 1
-#include <inttypes.h>
-
-struct test {
- long A;
- struct { unsigned X; unsigned Y; } S;
- struct test* next;
-};
-
-struct test TestArray[10];
-struct test Test1;
-
-/* Create global symbolic constants from the addresses of the above globals */
-
-struct test* TestArrayPtr = &TestArray[3];
-long* Aptr = &Test1.A;
-unsigned* Yptr = &Test1.S.Y;
-struct test** NextPtr = &Test1.next;
-
-void
-printdiff(void* p1, void* p2)
-{
- printf(" %d", (int)((unsigned long) p1 - (unsigned long) p2));
-}
-
-int
-main(int argc, char** argv)
-{
- unsigned long diff1, diff2, diff3, diff4;
-
- printf("sizeof(struct Test) = %d\n\n", (int)sizeof(struct test));
-
- printdiff(&TestArray[3], TestArray);
- printdiff(&Test1.S.Y, &Test1.A);
- printdiff(&Test1.next, &Test1.S.Y);
- printf("\n");
-
- diff1 = (unsigned long) &TestArray[3] - (unsigned long) TestArray;
- diff3 = (unsigned long) &Test1.S.Y - (unsigned long) &Test1.A;
- diff4 = (unsigned long) &Test1.next - (unsigned long) &Test1.S.Y;
-
- printf("&TestArray[3] - TestArray = 0x%lx\n", diff1);
- printf("Xptr - Aptr = 0x%lx\n", diff3);
- printf("NextPtr - Xptr = 0x%lx\n\n", diff4);
-
- diff1 = (unsigned long) TestArrayPtr - (unsigned long) TestArray;
- diff3 = (unsigned long) Yptr - (unsigned long) Aptr;
- diff4 = (unsigned long) NextPtr - (unsigned long) Yptr;
-
- printf("&TestArray[3] - TestArray = 0x%lx\n", diff1);
- printf("Xptr - Aptr = 0x%lx\n", diff3);
- printf("NextPtr - Xptr = 0x%lx\n\n", diff4);
-
- return 0;
-}
+++ /dev/null
-#ifdef __GNUC__
-unsigned int gnu_dev_major (unsigned long long int __dev)
-{
- return ((__dev >> 8) & 0xfff) | ((unsigned int) (__dev >> 32) & ~0xfff);
-}
-
-unsigned int gnu_dev_minor (unsigned long long int __dev)
-{
- return (__dev & 0xff) | ((unsigned int) (__dev >> 12) & ~0xff);
-}
-
-unsigned long long int gnu_dev_makedev (unsigned int __major, unsigned int __minor)
-{
- return ((__minor & 0xff) | ((__major & 0xfff) << 8)
- | (((unsigned long long int) (__minor & ~0xff)) << 12)
- | (((unsigned long long int) (__major & ~0xfff)) << 32));
-}
-#endif
-
-int main()
-{
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-#define MAXPRINTABLE 128
-#include "rantext.h"
-#if ULTRIX || _AIX || _WIN32
-#include <fcntl.h>
-#else
-#include <sys/fcntl.h>
-#endif
-
-double ran();
-double ran2();
-char getranchar();
-#define BUFFERSIZE 14500000
-long int seedi;
-#define COMPRESS 0
-#define UNCOMPRESS 1
-
-double prob_tab[MAXPRINTABLE][MAXPRINTABLE];
-
-int
-add_line(char* buf, int count, int num_letters, char letter)
-{
-int i;
- for (i = count; i < (count + num_letters); i ++)
- {
- buf[i]=letter;
- }
- count=i;
- buf[count]='\n';
- count=count+1;
- return(count);
-}
-
-fill_text_buffer(int count, char start_char, char* text_buffer)
-{
- long int total; /* normalization */
- int i,j; /* array indexers */
- char c1,c2; /* character holders for level-three search */
- int bufindex;
-
- /*
- * For each ith, jth element in the frequency table, set the
- * ith, jth, element of the probability table to the frequency
- * table entry divided by the total.
- */
-
- for (i=0;i<128;i++)
- {
- total = 0.0;
- for (j=0;j<128;j++)
- {
- total += freq_tab[i][j];
- }
- if (total<1)
- total=1;
- for (j=0;j<128;j++)
- {
- prob_tab[i][j] = (double)freq_tab[i][j]/(double)total;
- }
- }
- /*
- * For each ith element in the probability table, make the
- * jth elements cumulative in order to simplify 'getranchar'.
- */
-
- for (i=0;i<128;i++)
- {
- for (j=1;j<128;j++)
- {
- prob_tab[i][j]+=prob_tab[i][j-1];
- }
- }
-
-#if SDEBUG
- fprintf(stderr,
- "Probability table built, about to open file \n");
- fflush(stderr) ;
-#endif /* SDEBUG */
-
- /*
- * Start off the simulation with seed letter.
- */
-
- c1=start_char;
-
- /*
- * Get "count" characters and spit 'em out.
- */
-
- count-- ; /* pre-decrement for the final new line */
-
- bufindex = 0 ;
- while (count>0)
- {
- c2=getranchar(c1,ran2());
- text_buffer[bufindex++]=c2 ;
-#if SDEBUG>2
- fprintf(stderr,"Character number %d is %c\n",
- bufindex,c2) ;
- fflush(stderr) ;
-#endif /* SDEBUG */
- c1=c2;
- count--;
- }
- /*
- * Complete the last line
- */
-
- c2 = '\n' ;
- text_buffer[bufindex++]=c2 ;
-}
-
-/* Routine For dumping contents of a buffer to the output
- Jeff Reilly, 1/15/95 */
-print_buffer(int count, char* text_buffer)
-
-{
-int i;
-
-for (i=0;i<count;i++)
- printf("%c", text_buffer[i]);
-
-
-}
-
-char getranchar(c,rnno)
-char c;
-double rnno;
-
-{
- int mid, k;
- int low=0;
- int high=127;
-
- /*
- * Ascend the jth column (given by c1).
- * if the cumulative probability exceeds the random number, then
- * the current (char) i is the character to return.
- */
- if (rnno > prob_tab[c][127])
- return ('e');
-
- for (k=0;k<7;k++)
- {
- mid = (low+high)>>1;
- if (rnno < prob_tab[c][mid])
- high = mid;
- else if (rnno > prob_tab[c][mid])
- low = mid + 1;
- else /* exact match found -unlikely */
- return ((char)mid);
- }
- return ((char)low);
-}
-
-double ran2()
-{
- seedi=((314157*seedi)+19)&0xffffff;
- return ( (double) seedi/(double)0xffffff);
-}
-
-double ran()
-/* See "Random Number Generators: Good Ones Are Hard To Find", */
-/* Park & Miller, CACM 31#10 October 1988 pages 1192-1201. */
-/***********************************************************/
-/* THIS IMPLEMENTATION REQUIRES AT LEAST 32 BIT INTEGERS ! */
-/***********************************************************/
-#define _A_MULTIPLIER 16807L
-#define _M_MODULUS 2147483647L /* (2**31)-1 */
-#define _Q_QUOTIENT 127773L /* 2147483647 / 16807 */
-#define _R_REMAINDER 2836L /* 2147483647 % 16807 */
-{
- long lo;
- long hi;
- long test;
-
- hi = seedi / _Q_QUOTIENT;
- lo = seedi % _Q_QUOTIENT;
- test = _A_MULTIPLIER * lo - _R_REMAINDER * hi;
- if (test > 0) {
- seedi = test;
- } else {
- seedi = test + _M_MODULUS;
- }
- return ( (float) seedi / _M_MODULUS);
-}
-
-compare_buffer(char* buf1, int count1, char* buf2, int count2)
-{
-if (count1 == count2)
-{
- printf("Files both have length %d\n", count1);
- if (count1 > 0)
- {
- if ( (buf1[0] == buf2[0]) && (buf1[count1-1] == buf2[count2-1]) )
- {
- printf("First character (%c) and Last Character (%c) match. \n", buf1[0], buf1[count1-1]);
- }
- else
- {
- printf("First and last characters do not match.\n");
- printf("%c does not match %c\n", buf1[0], buf2[0]);
- printf("or %c does not match %c\n", buf1[count1-1], buf2[count2-1]);
- }
- }
-}
-else
-{
- printf("Warning: Files of differing lengths: %d and %d\n", count1, count2);
-}
-
-
-}
-
-char orig_text_buffer[BUFFERSIZE], comp_text_buffer[BUFFERSIZE], new_text_buffer[BUFFERSIZE];
-
-
-int main(int argc, char *argv[])
-
-{
-int count, i;
-int new_count;
-char start_char;
-int comp_count = 0;
-
- printf("SPEC 129.compress harness\n");
-
- //scanf("%i %c %li", &count, &start_char, &seedi);
- count = 10;
- start_char=10;
- seedi = 12345;
- printf("Initial File Size:%i Start character:%c\n", count, start_char, seedi);
- fill_text_buffer(count, start_char, orig_text_buffer);
- for (i = 1; i <= 25; i++)
- {
- new_count=add_line(orig_text_buffer, count, i, start_char);
- count=new_count;
- //oper=COMPRESS;
- printf("The starting size is: %d\n", count);
- //comp_count=spec_select_action(orig_text_buffer, count, oper, comp_text_buffer);
- printf("The compressed size is: %d\n", comp_count);
- //oper=UNCOMPRESS;
- //new_count=spec_select_action(comp_text_buffer, comp_count, oper, new_text_buffer);
- printf("The compressed/uncompressed size is: %d\n", new_count);
- //compare_buffer(orig_text_buffer, count, new_text_buffer, new_count);
- }
-/* Remove comments for Debugging */
-/*
- printf("Original Text File:\n");
- print_buffer(count, orig_text_buffer);
- printf("New Text File:\n");
- print_buffer(count, new_text_buffer); */
-
- return 0;
-}
+++ /dev/null
-#include <math.h>
-
-int main(int argc)
-{
- printf("%d\n", abs(argc));
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-#include <assert.h>
-
-int test1(int a)
-{
- return a == 0;
-}
-
-int test2(int a, int b)
-{
- return a == b;
-}
-
-int test2a(int a, int b)
-{
- return a != b;
-}
-
-int test3(int a, int b)
-{
- return a == 0 && b + 1 < 10;
-}
-
-int test4(int a, int b)
-{
- return a == 0 || b + 1 < 10;
-}
-
-int test5(int a, int b)
-{
- return a > b ? a : b - 1;
-}
-
-int test6(int a, int b)
-{
- return a < 0 ? -1 : (a > 0 ? 1 : 0);
-}
-
-int test6a(int a, int b)
-{
- if(a < b)
- ;
- else
- ;
-
- return 0;
-}
-
-int test7(int a, int b)
-{
- int i, res = 0;
-
- for(i = 0; i < a; ++i)
- res += i * b;
-
- return res;
-}
-
-int test8(int a, int b, int c)
-{
- return a < b ? (a < c ? a : c) : (b < c ? b : c);
-}
-
-int test9(int a, int b)
-{
- return a ? b : b;
-}
-
-int testam(int a, int b, int c)
-{
- if(a < 42)
- return b;
- else
- return c;
-}
-
-int main()
-{
-#define TU(t,a,s) printf("%s(%d) = %d (should be %d)\n", \
- #t, a, t(a), s); \
- assert(t(a) == s);
-
-#define TB(t,a,b,s) printf("%s(%d,%d) = %d (should be %d)\n", \
- #t, a, b, t(a,b), s); \
- assert(t(a,b) == s);
-
-#define TT(t,a,b,c,s) printf("%s(%d,%d,%d) = %d (should be %d)\n", \
- #t, a, b, c, t(a,b,c), s); \
- assert(t(a,b,c) == s);
-
-
- TU(test1, 0, 1);
- TU(test1, 42, 0);
-
- TB(test2, 0, 0, 1);
- TB(test2, -23, -23, 1);
- TB(test2, 0, 42, 0);
- TB(test2, -1, 0, 0);
-
- TB(test2a, 0, 0, 0);
- TB(test2a, -23, -23, 0);
- TB(test2a, 0, 42, 1);
- TB(test2a, -1, 0, 1);
-
- TB(test3, 0, 8, 1);
- TB(test3, 0, -200, 1);
- TB(test3, 0, 10, 0);
- TB(test3, 42, 8, 0);
- TB(test3, -1, -200, 0);
- TB(test3, -1, 10, 0);
-
- TB(test4, 0, 8, 1);
- TB(test4, 0, -200, 1);
- TB(test4, 0, 10, 1);
- TB(test4, 42, 8, 1);
- TB(test4, -1, -200, 1);
- TB(test4, -1, 10, 0);
-
- TB(test5, 42, -1, 42);
- TB(test5, 1, 0, 1);
- TB(test5, 0, 1, 0);
- TB(test5, -1, 42, 41);
-
- TB(test6, -5, 42, -1);
- TB(test6, -20, -1, -1);
- TB(test6, 20, -1, 1);
- TB(test6a, 42, -1, 0);
-
- TB(test7, 3, 2, 6);
-
- TT(test8, 0, 2, 3, 0);
- TT(test8, 0, 2, 1, 0);
- TT(test8, -1, 42, 5, -1);
- TT(test8, -7, 4, -42, -42);
- TT(test8, 0, 2, -1, -1);
- TT(test8, 24, 123, 7, 7);
-
- TT(testam, -24, 13, 7, 13);
- TT(testam, 102, 13, 7, 7);
-
- TB(test9, 3, 2, 2);
- TB(test9, -42, -42, -42);
-
- return 0;
-}
+++ /dev/null
-volatile int x = -1;
-
-int main(void) {
- x ++;
- return x;
-}
+++ /dev/null
-/**
- * magical invsqrt function from Quake III code
- * see: http://www.codemaestro.com/reviews/9
- */
-
-float InvSqrt(float x)
-{
- float xhalf = 0.5f*x;
- int i = *(int*)&x;
- i = 0x5f3759df - (i>>1);
- x = *(float*)&i;
- x = x*(1.5f-xhalf*x*x);
- return x;
-}
-
-int main(void) {
- int result = InvSqrt(0.00056);
- printf("Result: %d (should be 42)", result);
- return result != 42;
-}
+++ /dev/null
-#include <stdio.h>
-
-float kahanSum(const float A[], int n) {
- float sum = 0.0, C = 0.0, Y, T;
- int i;
-
- for (i = 0; i < n; ++i) {
- Y = A[i] - C;
- T = sum + Y;
- C = T - sum - Y;
- sum = T;
- }
- return sum;
-}
-
-int main()
-{
- float test[] = { 1,2,3,4,5,6,7,8,9};
- printf("Result: %f\n", kahanSum(test, sizeof(test)/sizeof(float)));
-
- return 0;
-}
+++ /dev/null
-/* The Computer Language Shootout Benchmarks
- http://shootout.alioth.debian.org/
-
- contributed by Kevin Carson
- compilation:
- gcc -O3 -fomit-frame-pointer -funroll-loops -static binary-trees.c -lm
- icc -O3 -ip -unroll -static binary-trees.c -lm
-*/
-
-//#include <malloc.h>
-#include <math.h>
-#include <stdio.h>
-#include <stdlib.h>
-
-
-typedef struct tn {
- struct tn* left;
- struct tn* right;
- long item;
-} treeNode;
-
-
-static
-treeNode* NewTreeNode(treeNode* left, treeNode* right, long item)
-{
- treeNode* new;
-
- new = (treeNode*)malloc(sizeof(treeNode));
-
- new->left = left;
- new->right = right;
- new->item = item;
-
- return new;
-} /* NewTreeNode() */
-
-static
-long ItemCheck(treeNode* tree)
-{
- if (tree->left == NULL)
- return tree->item;
- else
- return tree->item + ItemCheck(tree->left) - ItemCheck(tree->right);
-} /* ItemCheck() */
-
-static
-treeNode* BottomUpTree(long item, unsigned depth)
-{
- if (depth > 0)
- return NewTreeNode
- (
- BottomUpTree(2 * item - 1, depth - 1),
- BottomUpTree(2 * item, depth - 1),
- item
- );
- else
- return NewTreeNode(NULL, NULL, item);
-} /* BottomUpTree() */
-
-static
-void DeleteTree(treeNode* tree)
-{
- if (tree->left != NULL)
- {
- DeleteTree(tree->left);
- DeleteTree(tree->right);
- }
-
- free(tree);
-} /* DeleteTree() */
-
-
-int main(int argc, char* argv[])
-{
- unsigned N, depth, minDepth, maxDepth, stretchDepth;
- treeNode *stretchTree, *longLivedTree, *tempTree;
-
- if(argc < 2) {
- N = 10;
- printf("Using default input %d\n", N);
- } else {
- N = atol(argv[1]);
- }
-
- minDepth = 4;
-
- if ((minDepth + 2) > N)
- maxDepth = minDepth + 2;
- else
- maxDepth = N;
-
- stretchDepth = maxDepth + 1;
-
- stretchTree = BottomUpTree(0, stretchDepth);
- printf
- (
- "stretch tree of depth %u\t check: %li\n",
- stretchDepth,
- ItemCheck(stretchTree)
- );
-
- DeleteTree(stretchTree);
-
- longLivedTree = BottomUpTree(0, maxDepth);
-
- for (depth = minDepth; depth <= maxDepth; depth += 2)
- {
- long i, iterations, check;
-
- iterations = pow(2, maxDepth - depth + minDepth);
-
- check = 0;
-
- for (i = 1; i <= iterations; i++)
- {
- tempTree = BottomUpTree(i, depth);
- check += ItemCheck(tempTree);
- DeleteTree(tempTree);
-
- tempTree = BottomUpTree(-i, depth);
- check += ItemCheck(tempTree);
- DeleteTree(tempTree);
- } /* for(i = 1...) */
-
- printf
- (
- "%li\t trees of depth %u\t check: %li\n",
- iterations * 2,
- depth,
- check
- );
- } /* for(depth = minDepth...) */
-
- printf
- (
- "long lived tree of depth %u\t check: %li\n",
- maxDepth,
- ItemCheck(longLivedTree)
- );
-
- return 0;
-} /* main() */
+++ /dev/null
-/*
- * The Computer Lannguage Shootout
- * http://shootout.alioth.debian.org/
- * Contributed by Heiner Marxen
- *
- * "fannkuch" for C gcc
- *
- * $Id$
- */
-
-#include <stdio.h>
-#include <stdlib.h>
-
-#define Int int
-#define Aint int
-
- static long
-fannkuch( int n )
-{
- Aint* perm;
- Aint* perm1;
- Aint* count;
- long flips;
- long flipsMax;
- Int r;
- Int i;
- Int k;
- Int didpr;
- const Int n1 = n - 1;
-
- if( n < 1 ) return 0;
-
- perm = calloc(n, sizeof(*perm ));
- perm1 = calloc(n, sizeof(*perm1));
- count = calloc(n, sizeof(*count));
-
- for( i=0 ; i<n ; ++i ) perm1[i] = i; /* initial (trivial) permu */
-
- r = n; didpr = 0; flipsMax = 0;
- for(;;) {
- if( didpr < 30 ) {
- for( i=0 ; i<n ; ++i )
- printf("%d", (int)(1+perm1[i]));
- printf("\n");
- ++didpr;
- }
-
- for( ; r!=1 ; --r ) {
- count[r-1] = r;
- }
-
-#define XCH(x,y) { Aint t_mp; t_mp=(x); (x)=(y); (y)=t_mp; }
-
- if( ! (perm1[0]==0 || perm1[n1]==n1) ) {
- flips = 0;
- for( i=1 ; i<n ; ++i ) { /* perm = perm1 */
- perm[i] = perm1[i];
- }
- k = perm1[0]; /* cache perm[0] in k */
- do { /* k!=0 ==> k>0 */
- Int j;
- for( i=1, j=k-1 ; i<j ; ++i, --j ) {
- XCH(perm[i], perm[j])
- }
- ++flips;
- /*
- * Now exchange k (caching perm[0]) and perm[k]... with care!
- * XCH(k, perm[k]) does NOT work!
- */
- j=perm[k]; perm[k]=k ; k=j;
- }while( k );
-
- if( flipsMax < flips ) {
- flipsMax = flips;
- }
- }
-
- for(;;) {
- if( r == n ) {
- return flipsMax;
- }
- /* rotate down perm[0..r] by one */
- {
- Int perm0 = perm1[0];
- i = 0;
- while( i < r ) {
- k = i+1;
- perm1[i] = perm1[k];
- i = k;
- }
- perm1[r] = perm0;
- }
-
- if( (count[r] -= 1) > 0 ) {
- break;
- }
- ++r;
- }
- }
-}
-
-int
-main( int argc, char* argv[] )
-{
- int n = (argc>1) ? atoi(argv[1]) : 10;
-
- printf("Pfannkuchen(%d) = %ld\n", n, fannkuch(n));
- return 0;
-}
+++ /dev/null
-/* -*- mode: c -*-
- * $Id$
- * http://shootout.alioth.debian.org/
- *
- * by Paul Hsieh
- */
-
-#include <stdio.h>
-#include <stdlib.h>
-
-#define IM 139968
-#define IA 3877
-#define IC 29573
-
-double gen_random (double max) {
- static long last = 42;
- return max * (last = (last * IA + IC) % IM) / IM;
-}
-
-struct aminoacids {
- char c;
- double p;
-};
-
-/* Weighted selection from alphabet */
-
-void makeCumulative (struct aminoacids * genelist, int count) {
- double cp = 0.0;
- int i;
-
- for (i=0; i < count; i++) {
- cp += genelist[i].p;
- genelist[i].p = cp;
- }
-}
-
-char selectRandom (const struct aminoacids * genelist, int count) {
- double r = gen_random (1);
- int i, lo, hi;
-
- if (r < genelist[0].p) return genelist[0].c;
-
- lo = 0;
- hi = count-1;
-
- while (hi > lo+1) {
- i = (hi + lo) / 2;
- if (r < genelist[i].p) hi = i; else lo = i;
- }
- return genelist[hi].c;
-}
-
-/* Generate and write FASTA format */
-
-#define LINE_LENGTH (60)
-
-void makeRandomFasta (const char * id, const char * desc, const struct
-aminoacids * genelist, int count, int n) {
- int todo = n;
- int i, m;
-
- printf (">%s %s\n", id, desc);
-
- for (; todo > 0; todo -= LINE_LENGTH) {
- char pick[LINE_LENGTH+1];
- if (todo < LINE_LENGTH) m = todo; else m = LINE_LENGTH;
- for (i=0; i < m; i++) pick[i] = selectRandom (genelist, count);
- pick[m] = '\0';
- puts (pick);
- }
-}
-
-void makeRepeatFasta (const char * id, const char * desc, const char *
-s, int n) {
- char * ss;
- int todo = n, k = 0, kn = strlen (s);
- int m;
-
- ss = (char *) malloc (kn + 1);
- memcpy (ss, s, kn+1);
-
- printf (">%s %s\n", id, desc);
-
- for (; todo > 0; todo -= LINE_LENGTH) {
- if (todo < LINE_LENGTH) m = todo; else m = LINE_LENGTH;
-
- while (m >= kn - k) {
- printf ("%s", s+k);
- m -= kn - k;
- k = 0;
- }
-
- ss[k + m] = '\0';
- puts (ss+k);
- ss[k + m] = s[m+k];
- k += m;
- }
-
- free (ss);
-}
-
-/* Main -- define alphabets, make 3 fragments */
-
-struct aminoacids iub[] = {
- { 'a', 0.27 },
- { 'c', 0.12 },
- { 'g', 0.12 },
- { 't', 0.27 },
-
- { 'B', 0.02 },
- { 'D', 0.02 },
- { 'H', 0.02 },
- { 'K', 0.02 },
- { 'M', 0.02 },
- { 'N', 0.02 },
- { 'R', 0.02 },
- { 'S', 0.02 },
- { 'V', 0.02 },
- { 'W', 0.02 },
- { 'Y', 0.02 }
-};
-
-#define IUB_LEN (sizeof (iub) / sizeof (struct aminoacids))
-
-struct aminoacids homosapiens[] = {
- { 'a', 0.3029549426680 },
- { 'c', 0.1979883004921 },
- { 'g', 0.1975473066391 },
- { 't', 0.3015094502008 },
-};
-
-#define HOMOSAPIENS_LEN (sizeof (homosapiens) / sizeof (struct aminoacids))
-
-char * alu =
- "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"
- "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"
- "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"
- "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"
- "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"
- "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"
- "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
-
-int main (int argc, char * argv[]) {
- int n = 1000;
-
- if (argc > 1) sscanf (argv[1], "%d", &n);
-
- makeCumulative (iub, IUB_LEN);
- makeCumulative (homosapiens, HOMOSAPIENS_LEN);
-
- makeRepeatFasta ("ONE", "Homo sapiens alu", alu, n*2);
- makeRandomFasta ("TWO", "IUB ambiguity codes", iub, IUB_LEN, n*3);
- makeRandomFasta ("THREE", "Homo sapiens frequency", homosapiens,
-HOMOSAPIENS_LEN, n*5);
-
- return 0;
-}
+++ /dev/null
-/*
- * The Great Computer Language Shootout
- * http://shootout.alioth.debian.org/
- *
- * contributed by Christoph Bauer
- *
- */
-
-#include <math.h>
-#include <stdio.h>
-#include <stdlib.h>
-
-#define pi 3.141592653589793
-#define solar_mass (4 * pi * pi)
-#define days_per_year 365.24
-
-struct planet {
- double x, y, z;
- double vx, vy, vz;
- double mass;
-};
-
-void advance(int nbodies, struct planet * bodies, double dt)
-{
- int i, j;
-
- for (i = 0; i < nbodies; i++) {
- struct planet * b = &(bodies[i]);
- for (j = i + 1; j < nbodies; j++) {
- struct planet * b2 = &(bodies[j]);
- double dx = b->x - b2->x;
- double dy = b->y - b2->y;
- double dz = b->z - b2->z;
- double distance = sqrt(dx * dx + dy * dy + dz * dz);
- double mag = dt / (distance * distance * distance);
- b->vx -= dx * b2->mass * mag;
- b->vy -= dy * b2->mass * mag;
- b->vz -= dz * b2->mass * mag;
- b2->vx += dx * b->mass * mag;
- b2->vy += dy * b->mass * mag;
- b2->vz += dz * b->mass * mag;
- }
- }
- for (i = 0; i < nbodies; i++) {
- struct planet * b = &(bodies[i]);
- b->x += dt * b->vx;
- b->y += dt * b->vy;
- b->z += dt * b->vz;
- }
-}
-
-double energy(int nbodies, struct planet * bodies)
-{
- double e;
- int i, j;
-
- e = 0.0;
- for (i = 0; i < nbodies; i++) {
- struct planet * b = &(bodies[i]);
- e += 0.5 * b->mass * (b->vx * b->vx + b->vy * b->vy + b->vz * b->vz);
- for (j = i + 1; j < nbodies; j++) {
- struct planet * b2 = &(bodies[j]);
- double dx = b->x - b2->x;
- double dy = b->y - b2->y;
- double dz = b->z - b2->z;
- double distance = sqrt(dx * dx + dy * dy + dz * dz);
- e -= (b->mass * b2->mass) / distance;
- }
- }
- return e;
-}
-
-void offset_momentum(int nbodies, struct planet * bodies)
-{
- double px = 0.0, py = 0.0, pz = 0.0;
- int i;
- for (i = 0; i < nbodies; i++) {
- px += bodies[i].vx * bodies[i].mass;
- py += bodies[i].vy * bodies[i].mass;
- pz += bodies[i].vz * bodies[i].mass;
- }
- bodies[0].vx = - px / solar_mass;
- bodies[0].vy = - py / solar_mass;
- bodies[0].vz = - pz / solar_mass;
-}
-
-#define NBODIES 5
-struct planet bodies[NBODIES] = {
- { /* sun */
- 0, 0, 0, 0, 0, 0, solar_mass
- },
- { /* jupiter */
- 4.84143144246472090e+00,
- -1.16032004402742839e+00,
- -1.03622044471123109e-01,
- 1.66007664274403694e-03 * days_per_year,
- 7.69901118419740425e-03 * days_per_year,
- -6.90460016972063023e-05 * days_per_year,
- 9.54791938424326609e-04 * solar_mass
- },
- { /* saturn */
- 8.34336671824457987e+00,
- 4.12479856412430479e+00,
- -4.03523417114321381e-01,
- -2.76742510726862411e-03 * days_per_year,
- 4.99852801234917238e-03 * days_per_year,
- 2.30417297573763929e-05 * days_per_year,
- 2.85885980666130812e-04 * solar_mass
- },
- { /* uranus */
- 1.28943695621391310e+01,
- -1.51111514016986312e+01,
- -2.23307578892655734e-01,
- 2.96460137564761618e-03 * days_per_year,
- 2.37847173959480950e-03 * days_per_year,
- -2.96589568540237556e-05 * days_per_year,
- 4.36624404335156298e-05 * solar_mass
- },
- { /* neptune */
- 1.53796971148509165e+01,
- -2.59193146099879641e+01,
- 1.79258772950371181e-01,
- 2.68067772490389322e-03 * days_per_year,
- 1.62824170038242295e-03 * days_per_year,
- -9.51592254519715870e-05 * days_per_year,
- 5.15138902046611451e-05 * solar_mass
- }
-};
-
-int main(int argc, char ** argv)
-{
- int n = 1000000;
- int i;
-
- if(argc > 1)
- n = atoi(argv[1]);
-
- offset_momentum(NBODIES, bodies);
- printf ("%.9f\n", energy(NBODIES, bodies));
- for (i = 1; i <= n; i++)
- advance(NBODIES, bodies, 0.01);
- printf ("%.9f\n", energy(NBODIES, bodies));
- return 0;
-}
+++ /dev/null
-/*
- * The Great Computer Language Shootout
- * http://shootout.alioth.debian.org/
- *
- * Written by Dima Dorfman, 2004
- * Compile: gcc -std=c99 -O2 -o nsieve_bits_gcc nsieve_bits.c
- */
-
-#include <limits.h>
-#include <stdio.h>
-#include <stdlib.h>
-#include <stdint.h>
-#include <string.h>
-
-typedef uint_fast8_t bits;
-#define NBITS (CHAR_BIT * sizeof(bits))
-
-static uintmax_t
-nsieve(uintmax_t m)
-{
- uintmax_t count, i, j;
- bits a[m / NBITS];
-
- memset(a, (1 << CHAR_BIT) - 1, sizeof(a));
- count = 0;
- for (i = 2; i < m; ++i)
- if (a[i / NBITS] & (1 << i % NBITS)) {
- for (j = i + i; j < m; j += i)
- a[j / NBITS] &= ~(1 << j % NBITS);
- ++count;
- }
- return (count);
-}
-
-static void
-test(unsigned long n)
-{
- uintmax_t count, m;
-
- m = (1 << n) * 10000;
- count = nsieve(m);
- printf("Primes up to %8ju %8ju\n", m, count);
-}
-
-int
-main(int argc, char **argv)
-{
- unsigned long n = 9;
- char *cp;
-
- if(argc > 1)
- n = atoi(argv[1]);
- test(n);
- if (n >= 1)
- test(n - 1);
- if (n >= 2)
- test(n - 2);
- exit(0);
-}
+++ /dev/null
-// The Computer Language Shootout
-// http://shootout.alioth.debian.org/
-// Precedent C entry modified by bearophile for speed and size, 31 Jan 2006
-// Compile with: -O3 -s -std=c99 -fomit-frame-pointer
-
-#include <stdio.h>
-#include <stdlib.h>
-#include <string.h>
-
-typedef unsigned char boolean;
-
-
-static void nsieve(int m) {
- unsigned int count = 0, i, j;
- boolean * flags = (boolean *) malloc(m * sizeof(boolean));
- memset(flags, 1, m);
-
- for (i = 2; i < m; ++i)
- if (flags[i]) {
- ++count;
- for (j = i << 1; j < m; j += i)
- if (flags[j]) flags[j] = 0;
- }
-
- free(flags);
- printf("Primes up to %8u %8u\n", m, count);
-}
-
-int main(int argc, char * argv[]) {
- int i;
- int m = 8;
-
- if(argc > 1)
- m = atoi(argv[1]);
-
- for (i = 0; i < 3; i++)
- nsieve(10000 << (m-i));
- return 0;
-}
+++ /dev/null
-/*
-** The Computer Language Shootout
-** http://shootout.alioth.debian.org/
-** contributed by Mike Pall
-** de-optimized by Isaac Gouy
-**
-** compile with:
-** gcc -O3 -fomit-frame-pointer -ffast-math -o partialsums partialsums.c -lm
-** Adding -march=<yourcpu> may help, too.
-** On a P4/K8 or later try adding: --march=<yourcpu> -mfpmath=sse -msse2
-*/
-
-#include <stdio.h>
-#include <stdlib.h>
-#include <math.h>
-
-int main(int argc, char **argv)
-{
- int k;
- int n = 100000;
- double sum, a;
-
- if(argc > 1)
- n = atoi(argv[1]);
-
-/*
-** Yes, I (Mike Pall) tried using a double as a primary or secondary loop variable.
-** But the x86 ABI requires a cleared x87 FPU stack before every call
-** (e.g. to sin()) which nullifies any performance gains.
-**
-** Combining all loops does not pay off because the x87 FPU has to shuffle
-** stack slots and/or runs out of registers. This may not be entirely true
-** for SSE2 with fully inlined FPU code (-ffast-math required). Dito for
-** other CPUs with a register-based FPU and a sane FP ABI.
-**
-** Auto vectorization may be a bit easier with separate loops, too.
-*/
-
-#define kd ((double)k)
-
- sum = 0.0;
- for (k = 0; k <= n; k++) sum += pow(2.0/3.0, kd);
- printf("%.9f\t(2/3)^k\n", sum);
-
- sum = 0.0;
- for (k = 1 ; k <= n; k++) sum += 1/sqrt(kd); /* aka pow(kd, -0.5) */
- printf("%.9f\tk^-0.5\n", sum);
-
- sum = 0.0;
- for (k = 1; k <= n; k++) sum += 1.0/(kd*(kd+1.0));
- printf("%.9f\t1/k(k+1)\n", sum);
-
- sum = 0.0;
- for (k = 1; k <= n; k++) {
- double sk = sin(kd);
- sum += 1.0/(kd*kd*kd*sk*sk);
- }
- printf("%.9f\tFlint Hills\n", sum);
-
- sum = 0.0;
- for (k = 1; k <= n; k++) {
- double ck = cos(kd);
- sum += 1.0/(kd*kd*kd*ck*ck);
- }
- printf("%.9f\tCookson Hills\n", sum);
-
- sum = 0.0;
- for (k = 1; k <= n; k++) sum += 1.0/kd;
- printf("%.9f\tHarmonic\n", sum);
-
- sum = 0.0;
- for (k = 1; k <= n; k++) sum += 1.0/(kd*kd);
- printf("%.9f\tRiemann Zeta\n", sum);
-
- sum = 0.0; a = -1.0;
- for (k = 1; k <= n; k++) sum += (a = -a)/kd;
- printf("%.9f\tAlternating Harmonic\n", sum);
-
- sum = 0.0; a = -1.0;
- for (k = 1; k <= n; k++) sum += (a = -a)/(2.0*kd - 1.0);
- printf("%.9f\tGregory\n", sum);
-
- return 0;
-}
+++ /dev/null
-// The Computer Language Shootout
-// http://shootout.alioth.debian.org/
-// recursive test, by bearophile, Jan 24 2006
-// Compile with: -O3 -s -fomit-frame-pointer -funroll-loops
-
-#include <stdio.h>
-
-int Ack(int x, int y) {
- if (x == 0)
- return y+1;
- if (y == 0)
- return Ack(x-1, 1);
- return Ack(x-1, Ack(x, y-1));
-}
-
-int Fib(int n) {
- if (n < 2)
- return 1;
- return Fib(n-2) + Fib(n-1);
-}
-
-double FibFP(double n) {
- if (n < 2.0)
- return 1.0;
- return FibFP(n-2.0) + FibFP(n-1.0);
-}
-
-int Tak(int x, int y, int z) {
- if (y < x)
- return Tak( Tak(x-1, y, z), Tak(y-1, z, x), Tak(z-1, x, y) );
- return z;
-}
-
-double TakFP(double x, double y, double z) {
- if (y < x)
- return TakFP( TakFP(x-1.0, y, z), TakFP(y-1.0, z, x), TakFP(z-1.0, x, y) );
- return z;
-}
-
-int main(int argc, char **argv) {
- int n = 7;
-
- if(argc > 1)
- n = atoi(argv[1]) - 1;
- printf("Ack(3,%d): %d\n", n+1, Ack(3, n+1));
- printf("Fib(%.1f): %.1f\n", 28.0+n, FibFP(28.0+n));
- printf("Tak(%d,%d,%d): %d\n", 3*n, 2*n, n, Tak(3*n, 2*n, n));
- printf("Fib(3): %d\n", Fib(3));
- printf("Tak(3.0,2.0,1.0): %.1f\n", TakFP(3.0, 2.0, 1.0));
- return 0;
-}
+++ /dev/null
-/* -*- mode: c -*-
- *
- * The Great Computer Language Shootout
- * http://shootout.alioth.debian.org/
- *
- * Contributed by Sebastien Loisel
- */
-
-#include <stdio.h>
-#include <stdlib.h>
-#include <math.h>
-/* Includes for alloca() */
-#if defined(__FreeBSD__)
-#include <stdlib.h>
-#elif defined(_WIN32)
-#include <malloc.h>
-#else
-#include <alloca.h>
-#endif
-
-double eval_A(int i, int j) { return 1.0/((i+j)*(i+j+1)/2+i+1); }
-
-void eval_A_times_u(int N, const double u[], double Au[])
-{
- int i,j;
- for(i=0;i<N;i++)
- {
- Au[i]=0;
- for(j=0;j<N;j++) Au[i]+=eval_A(i,j)*u[j];
- }
-}
-
-void eval_At_times_u(int N, const double u[], double Au[])
-{
- int i,j;
- for(i=0;i<N;i++) {
- Au[i]=0;
- for(j=0;j<N;j++)
- Au[i] += eval_A(j,i)*u[j];
- }
-}
-
-void eval_AtA_times_u(int N, const double u[], double AtAu[])
-{
- double v[N];
- eval_A_times_u(N,u,v);
- eval_At_times_u(N,v,AtAu);
-}
-
-int main(int argc, char *argv[])
-{
- int i;
- int N = ((argc == 2) ? atoi(argv[1]) : 2000);
-
- double *u = alloca(sizeof(u[0]) * N);
- double *v = alloca(sizeof(v[0]) * N);
- double vBv, vv;
-
- for(i=0;i<N;i++)
- u[i]=1;
-
- for(i=0;i<10;i++) {
- eval_AtA_times_u(N,u,v);
- eval_AtA_times_u(N,v,u);
- }
-
- vBv = vv = 0;
-
- for(i=0;i<N;i++) {
- vBv+=u[i]*v[i];
- vv+=v[i]*v[i];
- }
-
- printf("%0.9f\n", sqrt(vBv/vv));
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-#include <stdlib.h>
-
-typedef long long int ll_t;
-typedef unsigned long long int ull_t;
-
-#ifdef __GNUC__
-ll_t mul_ll(ll_t a, ll_t b) __attribute__((noinline));
-ll_t shl_ll(ll_t a, ll_t b) __attribute__((noinline));
-ll_t shr_ll(ll_t a, ll_t b) __attribute__((noinline));
-ll_t add_ll(ll_t a, ll_t b) __attribute__((noinline));
-ll_t sub_ll(ll_t a, ll_t b) __attribute__((noinline));
-ll_t div_ll(ll_t a, ll_t b) __attribute__((noinline));
-ll_t mod_ll(ll_t a, ll_t b) __attribute__((noinline));
-ll_t divmod_ll(ll_t a, ll_t b) __attribute__((noinline));
-ll_t abs_ll(ll_t a) __attribute__((noinline));
-ll_t neg_ll(ll_t a) __attribute__((noinline));
-
-ull_t mul_ull(ull_t a, ull_t b) __attribute__((noinline));
-ull_t shl_ull(ull_t a, ull_t b) __attribute__((noinline));
-ull_t shr_ull(ull_t a, ull_t b) __attribute__((noinline));
-ull_t add_ull(ull_t a, ull_t b) __attribute__((noinline));
-ull_t sub_ull(ull_t a, ull_t b) __attribute__((noinline));
-ull_t div_ull(ull_t a, ull_t b) __attribute__((noinline));
-ull_t mod_ull(ull_t a, ull_t b) __attribute__((noinline));
-ull_t divmod_ull(ull_t a, ull_t b) __attribute__((noinline));
-ull_t neg_ull(ull_t a) __attribute__((noinline));
-#endif
-
-ll_t mul_ll(ll_t a, ll_t b) {
- return a * b;
-}
-
-ll_t shl_ll(ll_t a, ll_t b) {
- return a << b;
-}
-
-ll_t shr_ll(ll_t a, ll_t b) {
- return a >> b;
-}
-
-ll_t add_ll(ll_t a, ll_t b) {
- return a + b;
-}
-
-ll_t sub_ll(ll_t a, ll_t b) {
- return a - b;
-}
-
-ll_t div_ll(ll_t a, ll_t b) {
- return a / b;
-}
-
-ll_t mod_ll(ll_t a, ll_t b) {
- return a % b;
-}
-
-ll_t divmod_ll(ll_t a, ll_t b) {
- return (a / b) + (a % b);
-}
-
-ll_t neg_ll(ll_t a) {
- return -a;
-}
-
-ll_t abs_ll(ll_t a) {
- return a < 0 ? -a : a;
-}
-
-double conv_ll_d(ll_t a) {
- return (double)a;
-}
-
-ll_t conv_d_ll(double a) {
- return (ll_t)a;
-}
-
-/* unsigned */
-
-ull_t mul_ull(ull_t a, ull_t b) {
- return a * b;
-}
-
-ull_t shl_ull(ull_t a, ull_t b) {
- return a << b;
-}
-
-ull_t shr_ull(ull_t a, ull_t b) {
- return a >> b;
-}
-
-ull_t add_ull(ull_t a, ull_t b) {
- return a + b;
-}
-
-ull_t sub_ull(ull_t a, ull_t b) {
- return a - b;
-}
-
-ull_t div_ull(ull_t a, ull_t b) {
- return a / b;
-}
-
-ull_t mod_ull(ull_t a, ull_t b) {
- return a % b;
-}
-
-ull_t divmod_ull(ull_t a, ull_t b) {
- return (a / b) + (a % b);
-}
-
-ull_t neg_ull(ull_t a) {
- return -a;
-}
-
-#if 0
-double conv_ull_d(ull_t a) {
- return (double)a;
-}
-
-ull_t conv_d_ull(double a) {
- return (ull_t)a;
-}
-#endif
-
-int main(void) {
- ll_t a = 0xff;
- ll_t b = 0x123456789LL;
- ll_t c = 0x8001023000002460LL;
- double d = (double)c;
-
- ull_t ua = 0xff;
- ull_t ub = 0x123456789ULL;
- ull_t uc = 0x8001023000002460ULL;
-
- printf("%lld * %lld = %lld\n", a, b, mul_ll(a, b));
- printf("%lld + %lld = %lld\n", a, b, add_ll(a, b));
- printf("%lld - %lld = %lld\n", a, b, sub_ll(a, b));
- printf("%lld / %lld = %lld\n", b, a, div_ll(b, a));
- printf("%lld %% %lld = %lld\n", b, a, mod_ll(b, a));
- printf("%lld / + %% %lld = %lld\n", b, a, divmod_ll(b, a));
- printf("%lld << %d = %lld\n", a, 2, shl_ll(a, 2));
- printf("%lld << %d = %lld\n", a, 33, shl_ll(a, 33));
- printf("%lld >> %d = %lld\n", a, 2, shr_ll(a, 2));
- printf("%lld >> %d = %lld\n", c, 33, shr_ll(c, 33));
- printf("abs(%lld) = %lld\n", c, abs_ll(c));
- printf("neg(%lld) = %lld\n", b, neg_ll(b));
- printf("conv(%lld) = %lf\n", c, conv_ll_d(c));
- printf("conv(%lf) = %lld\n", d, conv_d_ll(d));
-
- printf("%llu * %llu = %llu\n", ua, ub, mul_ull(ua, ub));
- printf("%llu + %llu = %llu\n", ua, ub, add_ull(ua, ub));
- printf("%llu - %llu = %llu\n", ua, ub, sub_ull(ua, ub));
- printf("%llu / %llu = %llu\n", ub, ua, div_ull(ub, ua));
- printf("%llu %% %llu = %llu\n", ub, ua, mod_ull(ub, ua));
- printf("%llu / + %% %llu = %llu\n", ub, ua, divmod_ull(ub, ua));
- printf("%llu << %d = %llu\n", ua, 2, shl_ull(ua, 2));
- printf("%llu << %d = %llu\n", ua, 33, shl_ull(ua, 33));
- printf("%llu >> %d = %llu\n", ua, 2, shr_ull(ua, 2));
- printf("%llu >> %d = %llu\n", uc, 33, shr_ll(uc, 33));
- printf("neg(%llu) = %llu\n", ub, neg_ull(ub));
-#if 0
- printf("conv(%llu) = %lf\n", uc, conv_ull_d(uc));
- printf("conv(%lf) = %llu\n", d, conv_d_ull(d));
-#endif
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-long long fac(long long n)
-{
- if(n < 1)
- return 1;
-
- return (n*fac(n-1));
-}
-
-int main(void) {
- printf("Result:%lld (should be 3628800)\n",fac(10));
- printf("Result:%lld (should be 39916800)\n",fac(11));
- printf("Result:%lld (should be 479001600)\n",fac(12));
- printf("Result:%lld (should be 6227020800)\n",fac(13));
- printf("Result:%lld (should be 87178291200)\n",fac(14));
- printf("Result:%lld (should be 1307674368000)\n",fac(15));
- printf("Result:%lld (should be 20922789888000)\n",fac(16));
- printf("Result:%lld (should be 355687428096000)\n",fac(17));
- printf("Result:%lld (should be 6402373705728000)\n",fac(18));
- printf("Result:%lld (should be 121645100408832000)\n",fac(19));
- printf("Result:%lld (should be 2432902008176640000)\n",fac(20));
-
- return fac(20) != 2432902008176640000ULL;
-}
+++ /dev/null
-/*$ -fno-inline $*/
-#include <stdio.h>
-#include <math.h>
-
-#define CONST 42
-
-int mul0(int x)
-{
- return -x * CONST;
-}
-
-int mul1(int x, int y)
-{
- return -x * -y;
-}
-
-int mul2(int x, int y, int z)
-{
- return -x * (y - z);
-}
-
-int mul3(int x, int y, int z)
-{
- return (x - y) * z;
-}
-
-int sub0(int x, int y, int z)
-{
- return x - (y - z);
-}
-
-int sub1(int x, int y)
-{
- return x - (y * CONST);
-}
-
-int sub2(int x, int y)
-{
- return x - -y;
-}
-
-int sub3(int x, int y)
-{
- return -x - y;
-}
-
-int sub4(int x) {
- return 6 - ~x;
-}
-
-int addmul(int x, int y)
-{
-
-}
-
-int cmp1(int x, int y) {
- return -x == -y;
-}
-
-int cmp2(int x, int y) {
- return -x != -y;
-}
-
-int cmp3(int x, int y) {
- return ~x == ~y;
-}
-
-int cmp4(int x, int y) {
- return ~x != ~y;
-}
-
-int cmp5(int x, int y, int z) {
- return x + z == z + y;
-}
-
-int cmp6(int x, int y, int z) {
- return x + z != y + z;
-}
-
-int cmp7(int x, int y, int z) {
- return x - z == y - z;
-}
-
-int cmp8(int x, int y, int z) {
- return z -x != z - y;
-}
-
-int cmp9(int x) {
- return -x == 3;
-}
-
-int cmp10(int x) {
- return -x != 3;
-}
-
-int cmp11(int x, int y) {
- return x - y != x;
-}
-
-int cmp12(int x, int y) {
- return x + y == x && y + x == y;
-}
-
-int and1(int a, int b) {
- return (a|b)&a;
-}
-
-int and2(int a, int b) {
- return (a|b) & ~(a&b);
-}
-
-int and3(int a) {
- return (a & 2) == 2;
-}
-
-int and4(int a) {
- return (a & 2) == 4;
-}
-
-int and5(int a) {
- return (a & 2) != 4;
-}
-
-int or1(int a) {
- return (a | 2) != 0;
-}
-
-int or2(int a) {
- return (a | 7) == 0;
-}
-
-int add1(int x) {
- return x + ~x;
-}
-
-int shr1(int x) {
- return -(x >> 31);
-}
-
-int shrs1(unsigned x) {
- return -(x >> 31);
-}
-
-int demorgan1(int a, int b) {
- return (~a) & (~b);
-}
-
-int demorgan2(int a, int b) {
- return (~a) | (~b);
-}
-
-int eor1(int a, int b) {
- return a & (a ^ b);
-}
-
-int shl1(int a) {
- return (a << 3) == (5<<3);
-}
-
-int shl2(int a) {
- return (a << 3) == 41;
-}
-
-int shr2(unsigned int a) {
- return (a >> 3) == 5;
-}
-
-int shr3(unsigned int a) {
- return (a >> 3) == (1 << 29);
-}
-
-int shrs2(int a) {
- return (a >> 3) == 5;
-}
-
-int shrs3(int a) {
- return (a >> 3) == -5;
-}
-
-int shrs4(int a) {
- return (a >> 3) == (1 << 29);
-}
-
-int conv1(signed char a) {
- return (int)a < 0;
-}
-
-int conv2(unsigned char a) {
- return (int)a > 0;
-}
-
-int conv3(signed char a) {
- return (unsigned)a != 0;
-}
-
-int phi1(int x) {
- int a = x ? 23 : 42;
- int b = x ? 42 : 23;
- return a + b;
-}
-
-int phi2(int x) {
- int a = x ? 16 : 8;
- int b = x ? 4 : 2;
- return a / b;
-}
-
-int phi3(int x) {
- int a = x ? 5 : 9;
- int b = x ? 2 : 4;
- return a % b;
-}
-
-int phi4(int x) {
- int a = x ? 5 : 9;
- int b = x ? 2 : 4;
- return (a / b) + (a % b);
-}
-
-int abs1(int x) {
- return abs(-x);
-}
-
-int main(void)
-{
-#define TU(func,x,expect) \
- printf("%s(%d) = %d (should be %d)\n", #func, x, func(x), expect);
-#define TB(func,x,y,expect) \
- printf("%s(%d,%d) = %d (should be %d)\n", #func, x, y, func(x,y), expect);
-#define TT(func,x,y,z,expect) \
- printf("%s(%d,%d,%d) = %d (should be %d)\n", #func, x, y, z, func(x,y,z), expect);
-
- TU(mul0, 3, -126);
- TB(mul1, 20, 3, 60);
- TT(mul2, 9, 2, 5, 27);
- TT(mul3, 5, 2, 9, 27);
- TT(sub0, 42, 17, 59, 84);
- TB(sub1, 23, 17, -691);
- TB(sub2, 42, 17, 59);
- TB(sub3, 42, 17, -59);
- TU(sub4, 42, 49);
- TB(cmp1, 42, 17, 0);
- TB(cmp2, 42, 17, 1);
- TB(cmp3, 42, 17, 0);
- TB(cmp4, 42, 17, 1);
- TT(cmp5, 42, 17, -4, 0);
- TT(cmp6, 42, 17, -4, 1);
- TT(cmp7, 42, 17, -4, 0);
- TT(cmp8, 42, 17, -4, 1);
- TU(cmp9, -3, 1);
- TU(cmp10, -3, 0);
- TB(cmp11, 5, 5, 1);
- TB(cmp11, 42, 0, 0);
- TB(cmp12, 0, 0, 1);
- TB(cmp12, 42, 5, 0);
- TB(cmp12, 5, 5, 0);
- TB(and1, 42, 17, 42);
- TB(and2, 42, 17, 42^17);
- TU(and3, 34, 1);
- TU(add1, -3, -1);
- TU(shr1, -3, 1);
- TU(shrs1, -3, -1);
- TB(demorgan1, 42, 17, ~(42|17));
- TB(demorgan2, 42, 17, ~(42&17));
- TB(eor1, 42, 44, 42&~44);
- TU(shl1, 5, 1);
- TU(shl1, 6, 0);
- TU(shl2, 5, 0);
- TU(shr2, 5<<3, 1);
- TU(shr2, 6<<3, 0);
- TU(shr3, 5, 0);
- TU(shrs2, 5<<3, 1);
- TU(shrs2, 6<<3, 0);
- TU(shrs3, -5<<3, 1);
- TU(shrs3, -6<<3, 0);
- TU(shrs4, 5, 0);
- TU(conv1, 3, 0);
- TU(conv2, 3, 1);
- TU(conv3, 3, 1);
- TU(and4, 7, 0);
- TU(and5, 7, 1);
- TU(or1, 7, 1);
- TU(or2, 7, 0);
- TU(phi1, 1, 65);
- TU(phi2, 1, 4);
- TU(phi3, 1, 1);
- TU(phi4, 1, 3);
- TU(abs1, 1, 1);
-}
+++ /dev/null
-/* the loop analysis produces strange loop depths here... */
-
-typedef struct OP {
- int bla;
- int blup;
- int op_seq;
- int op_type;
- struct OP *next;
-} OP;
-
-OP operation1;
-OP operation2 = { 1, 2, 0, 4, &operation1 };
-OP *ptr = &operation2;
-
-int main(int argc, char **argv)
-{
- OP *o = ptr;
-
- if(!o || o->op_seq)
- return;
- printf("%d\n", o->op_seq);
- rand();
-
- for( ; o; o = o->next) {
- if(o->op_seq)
- break;
- if(o->bla > 52)
- o->bla -= 20;
-
- switch(o->bla) {
- case 1:
- case 201:
- printf("%d\n", o->bla);
- break;
- default:
- printf("hmm\n");
-#if 0
- while(rand() > 10000)
- ;
-#endif
- break;
- case 500:
- printf("jummy\n");
- break;
- }
- }
- printf("hjo\n");
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-#include <stdlib.h>
-#include <time.h>
-
-int r = 0;
-int a1 = 0,
- a2 = 0,
- a3 = 0,
- a4 = 0,
- a5 = 0,
- a6 = 0,
- a7 = 0,
- a8 = 0,
- a9 = 0,
- a10 = 0,
- a11 = 0;
-
-int main() {
- int r1 = a1,
- r2 = a2,
- r3 = a3,
- r4 = a4,
- r5 = a5,
- r6 = a6,
- r7 = a7;
- int i, i2;
-
- for(i = 0; i < r; ++i) {
- int r8 = a8,
- r9 = a9,
- r10 = a10;
-#if 1
- for(i2 = 0; i2 < r; ++i2) {
- printf("%d %d %d\n", i2, r2, r9);
- }
-#endif
-
- printf("%d %d\n", i+1+r8+r9+r10, r2);
- i *= 2;
- }
-
- printf("%d", r1+r2+r3+r4+r5+r6+r7+i);
- return 0;
-}
+++ /dev/null
-#ifndef CHAR_BIT
-#define CHAR_BIT 8
-#endif
-
-#define ROL(a,b) (((a) << (b)) | ((a) >> ((sizeof (a) * CHAR_BIT) - (b))))
-#define ROR(a,b) (((a) >> (b)) | ((a) << ((sizeof (a) * CHAR_BIT) - (b))))
-
-unsigned long long testL(unsigned long long a, int cnt) {
- return cnt == 0 ? a : ROL(a, cnt);
-}
-
-unsigned long long testR(unsigned long long a, int cnt) {
- return cnt == 0 ? a : ROR(a, cnt);
-}
-
-int main() {
- int printf(const char *fmt, ...);
- int i;
-
- for (i = 0; i < 64; ++i) {
- printf("%lld %lld\n", testL(1, i), testR(1, i));
- }
- return 0;
-}
+++ /dev/null
-<?xml version="1.0"?>
-<xsl:stylesheet xmlns:xsl="http://www.w3.org/1999/XSL/Transform" version="1.0">
- <xsl:output method="html" indent="yes"
- doctype-public="-//W3C//DTD HTML 4.01//EN"
- doctype-system="http://www.w3.org/TR/html4/strict.dtd"/>
-
- <xsl:template name="resultcell" match="result/*/*">
- <xsl:element name="div">
- <xsl:if test="contains(text(), 'ok')">
- <xsl:attribute name="style">background-color: green; color: white;</xsl:attribute>
- </xsl:if>
- <xsl:if test="contains(text(), 'failed')">
- <xsl:attribute name="style">background-color: red; color: white;</xsl:attribute>
- </xsl:if>
-
- <xsl:choose>
- <xsl:when test="name() = 'gcc_run'">
- <xsl:element name="a">
- <xsl:choose>
- <xsl:when test="contains(text(), 'ok') or contains(text(), 'failed')">
- <xsl:attribute name="style">color: white;</xsl:attribute>
- </xsl:when>
- <xsl:otherwise>
- <xsl:attribute name="style">color: black;</xsl:attribute>
- </xsl:otherwise>
- </xsl:choose>
- <xsl:choose>
- <xsl:when test="name(..) = 'OLD'">
- <xsl:attribute name="href"><xsl:value-of select="substring(/results/files/OLD, 0, 15)"/>/result_gcc_<xsl:value-of select="../../@name"/>.txt</xsl:attribute>
- </xsl:when>
- <xsl:otherwise>
- <xsl:attribute name="href"><xsl:value-of select="substring(/results/files/NEW, 0, 15)"/>/result_gcc_<xsl:value-of select="../../@name"/>.txt</xsl:attribute>
- </xsl:otherwise>
- </xsl:choose>
- <xsl:value-of select="text()"/>
- </xsl:element>
- </xsl:when>
- <xsl:when test="name() = 'firm_run'">
- <xsl:element name="a">
- <xsl:choose>
- <xsl:when test="contains(text(), 'ok') or contains(text(), 'failed')">
- <xsl:attribute name="style">color: white;</xsl:attribute>
- </xsl:when>
- <xsl:otherwise>
- <xsl:attribute name="style">color: black;</xsl:attribute>
- </xsl:otherwise>
- </xsl:choose>
- <xsl:choose>
- <xsl:when test="name(..) = 'OLD'">
- <xsl:attribute name="href">
- <xsl:value-of select="substring(/results/files/OLD, 0, 15)"/>/result_firm_<xsl:value-of select="../../@name"/>.txt</xsl:attribute></xsl:when>
- <xsl:otherwise>
- <xsl:attribute name="href"><xsl:value-of select="substring(/results/files/NEW, 0, 15)"/>/result_firm_<xsl:value-of select="../../@name"/>.txt</xsl:attribute>
- </xsl:otherwise>
- </xsl:choose>
- <xsl:value-of select="text()"/>
- </xsl:element>
- </xsl:when>
- <xsl:when test="name() = 'diff'">
- <xsl:element name="a">
- <xsl:choose>
- <xsl:when test="contains(text(), 'ok') or contains(text(), 'failed')">
- <xsl:attribute name="style">color: white;</xsl:attribute>
- </xsl:when>
- <xsl:otherwise>
- <xsl:attribute name="style">color: black;</xsl:attribute>
- </xsl:otherwise>
- </xsl:choose>
- <xsl:choose>
- <xsl:when test="name(..) = 'OLD'">
- <xsl:attribute name="href"><xsl:value-of select="substring(/results/files/OLD, 0, 15)"/>/result_diff_<xsl:value-of select="../../@name"/>.txt</xsl:attribute>
- </xsl:when>
- <xsl:otherwise>
- <xsl:attribute name="href"><xsl:value-of select="substring(/results/files/NEW, 0, 15)"/>/result_diff_<xsl:value-of select="../../@name"/>.txt</xsl:attribute>
- </xsl:otherwise>
- </xsl:choose>
- <xsl:value-of select="text()"/>
- </xsl:element>
- </xsl:when>
- <xsl:otherwise>
- <xsl:value-of select="text()"/>
- </xsl:otherwise>
- </xsl:choose>
- </xsl:element>
- </xsl:template>
-
- <xsl:template match="/">
- <html>
- <head>
- <title>Results</title>
- </head>
- <body>
- OLD: <xsl:value-of select="/results/files/OLD"/><br/>
- NEW: <xsl:value-of select="/results/files/NEW"/><br/><br/>
- <table>
- <tr>
- <th>Name</th>
- <th>Compile</th>
- <th>Link</th>
- <th>GCC Compile</th>
- <th>GCC Run</th>
- <th>Firm Run</th>
- <th>Results</th>
- </tr>
- <xsl:for-each select="/results/section">
- <tr>
- <th colspan="7" style="background-color: yellow; color: black;"><xsl:value-of select="@name"/></th>
- </tr>
- <xsl:for-each select="result">
- <tr>
- <th rowspan="2">
- <xsl:element name="a">
- <xsl:attribute name="href">buildresult_<xsl:value-of select="@name"/>.txt</xsl:attribute>
- <xsl:value-of select="@name"/>
- </xsl:element>
- </th>
- <td><xsl:apply-templates select="OLD/compile"/></td>
- <td><xsl:apply-templates select="OLD/link"/></td>
- <td><xsl:apply-templates select="OLD/gcc_compile"/></td>
- <td><xsl:apply-templates select="OLD/gcc_run"/></td>
- <td><xsl:apply-templates select="OLD/firm_run"/></td>
- <td><xsl:apply-templates select="OLD/diff"/></td>
- </tr>
- <tr>
- <td><xsl:apply-templates select="NEW/compile"/></td>
- <td><xsl:apply-templates select="NEW/link"/></td>
- <td><xsl:apply-templates select="NEW/gcc_compile"/></td>
- <td><xsl:apply-templates select="NEW/gcc_run"/></td>
- <td><xsl:apply-templates select="NEW/firm_run"/></td>
- <td><xsl:apply-templates select="NEW/diff"/></td>
- </tr>
- <tr>
- <th colspan="7"> </th>
- </tr>
- </xsl:for-each>
- </xsl:for-each>
- </table>
- </body>
- </html>
- </xsl:template>
-</xsl:stylesheet>
+++ /dev/null
-<?xml version="1.0"?>
-<xsl:stylesheet xmlns:xsl="http://www.w3.org/1999/XSL/Transform" version="1.0">
- <xsl:output method="html" indent="yes"
- doctype-public="-//W3C//DTD HTML 4.01//EN"
- doctype-system="http://www.w3.org/TR/html4/strict.dtd"/>
-
- <xsl:template name="resultcell" match="result/*">
- <xsl:element name="div">
- <xsl:if test="contains(text(), 'ok')">
- <xsl:attribute name="style">background-color: green; color: white;</xsl:attribute>
- </xsl:if>
- <xsl:if test="contains(text(), 'failed')">
- <xsl:attribute name="style">background-color: red; color: white;</xsl:attribute>
- </xsl:if>
-
- <xsl:choose>
- <xsl:when test="name() = 'gcc_run'">
- <xsl:element name="a">
- <xsl:choose>
- <xsl:when test="contains(text(), 'ok') or contains(text(), 'failed')">
- <xsl:attribute name="style">color: white;</xsl:attribute>
- </xsl:when>
- <xsl:otherwise>
- <xsl:attribute name="style">color: black;</xsl:attribute>
- </xsl:otherwise>
- </xsl:choose>
- <xsl:attribute name="href">result_gcc_<xsl:value-of select="../@name"/>.txt</xsl:attribute>
- <xsl:value-of select="text()"/>
- </xsl:element>
- </xsl:when>
- <xsl:when test="name() = 'firm_run'">
- <xsl:element name="a">
- <xsl:choose>
- <xsl:when test="contains(text(), 'ok') or contains(text(), 'failed')">
- <xsl:attribute name="style">color: white;</xsl:attribute>
- </xsl:when>
- <xsl:otherwise>
- <xsl:attribute name="style">color: black;</xsl:attribute>
- </xsl:otherwise>
- </xsl:choose>
- <xsl:attribute name="href">result_firm_<xsl:value-of select="../@name"/>.txt</xsl:attribute>
- <xsl:value-of select="text()"/>
- </xsl:element>
- </xsl:when>
- <xsl:when test="name() = 'diff'">
- <xsl:element name="a">
- <xsl:choose>
- <xsl:when test="contains(text(), 'ok') or contains(text(), 'failed')">
- <xsl:attribute name="style">color: white;</xsl:attribute>
- </xsl:when>
- <xsl:otherwise>
- <xsl:attribute name="style">color: black;</xsl:attribute>
- </xsl:otherwise>
- </xsl:choose>
- <xsl:attribute name="href">result_diff_<xsl:value-of select="../@name"/>.txt</xsl:attribute>
- <xsl:value-of select="text()"/>
- </xsl:element>
- </xsl:when>
- <xsl:otherwise>
- <xsl:value-of select="text()"/>
- </xsl:otherwise>
- </xsl:choose>
- </xsl:element>
- </xsl:template>
-
- <xsl:template match="/">
- <html>
- <head>
- <title>Results</title>
- </head>
- <body>
- <table>
- <tr>
- <th>Name</th>
- <th>Compile</th>
- <th>Link</th>
- <th>GCC Compile</th>
- <th>GCC Run</th>
- <th>Firm Run</th>
- <th>Results</th>
- </tr>
- <xsl:for-each select="/results/result">
- <tr>
- <td>
- <xsl:element name="a">
- <xsl:attribute name="href">buildresult_<xsl:value-of select="@name"/>.txt</xsl:attribute>
- <xsl:value-of select="@name"/>
- </xsl:element>
- </td>
- <td><xsl:apply-templates select="compile"/></td>
- <td><xsl:apply-templates select="link"/></td>
- <td><xsl:apply-templates select="gcc_compile"/></td>
- <td><xsl:apply-templates select="gcc_run"/></td>
- <td><xsl:apply-templates select="firm_run"/></td>
- <td><xsl:apply-templates select="diff"/></td>
- </tr>
- </xsl:for-each>
- </table>
- </body>
- </html>
- </xsl:template>
-</xsl:stylesheet>
+++ /dev/null
-#!/bin/bash
-
-export LANG=
-export LC_ALL=
-export LC_COLLATE=
-if test "$1" != "--recursive-hack"; then
- "$0" --recursive-hack "$@"
- exit $?
-else
- shift
-fi
-
-EXEC_PREFIX=
-if [ "$ECC" = "" ]; then
- ECC="eccp"
-fi
-#EXEC_PREFIX="qemu-arm"
-#ECC="/ben/beck/ipd/bin/eccp -march=arm -bra-chordal-co-algo=heur"
-ECC_CFLAGS="${ADDCFLAGS} -v -O3 -ffp-strict"
-GCC="icc -restrict"
-GCC_CFLAGS="-O0 -Itcc -fp-model precise"
-LINKFLAGS="-lm"
-TIMEOUT_COMPILE=300
-TIMEOUT_RUN=30
-ECC_LINK="gcc -m32"
-
-CFILES="*.c"
-OUTPUTDIR="stats-`date +%y.%m.%d`"
-
-mkdir -p build_firm
-mkdir -p build_gcc
-mkdir -p $OUTPUTDIR
-
-XMLRES=$OUTPUTDIR/result.xml
-cat > $XMLRES << __END__
-<?xml version="1.0"?>
-<results>
- <environment>
- <ECC_CFLAGS>${ECC_CFLAGS}</ECC_CFLAGS>
- <GCC_CFLAGS>${GCC_CFLAGS}</GCC_CFLAGS>
- </environment>
-__END__
-
-# so endless apps stop at some point...
-#ulimit -t 2
-
-basedir=`pwd`
-
-if [ -z "$1" ]; then
- DIRS=". langshootout ack"
-else
- for f in "$@"; do
- if test -d "$f"; then
- DIRS="$DIRS $f"
- else
- FILES="$FILES $f"
- fi
- done
-fi
-for d in $DIRS; do
- for f in $d/*.c; do
- FILES="$FILES $f"
- done
-done
-
-for file in $FILES; do
- curdir="`dirname $file`"
- COMPILE_RES="ok"
- LINK_RES="omitted"
- GCC_RES="ok"
- GCC_RUN_RES="omitted"
- FIRM_RUN_RES="omitted"
- DIFF_RES="omitted"
- FILE_FLAGS=`awk '/\/\\*\\$ .* \\$\\*\// { for (i = 2; i < NF; ++i) printf "%s ", $i }' $file`
-
- name="`basename $file .c`"
- obj_name="build_firm/$name.o"
- res="$OUTPUTDIR/buildresult_$name.txt"
- echo -n "Building $name"
- echo "Results for $name" > $res
- echo "*** ECC/FIRM Compile" >> $res
- CMD="ulimit -t ${TIMEOUT_COMPILE} ; ${ECC} -c -o ${obj_name} ${ECC_CFLAGS} ${FILE_FLAGS} ${file}"
- echo "$CMD" >> $res
- /bin/sh -c "$CMD" >> $res 2>&1 || { COMPILE_RES="failed"; echo -n " ... FAILED"; }
-
- if [ ${COMPILE_RES} = "ok" ]; then
- LINK_RES="ok"
- echo "*** Linking" >> $res
- CMD="${ECC_LINK} $obj_name ${LINKFLAGS} -o build_firm/$name.exe"
- echo "$CMD" >> $res
- $CMD >> $res 2>&1 || { LINK_RES="failed"; echo -n " ... FAILED"; }
- fi
-
- echo "*** GCC Compile" >> $res
- CMD="${GCC} ${GCC_CFLAGS} ${FILE_FLAGS} $file ${LINKFLAGS} -o build_gcc/$name.exe"
- echo "$CMD" >> $res
- /bin/sh -c "$CMD" >> $res 2>&1 || { GCC_RES="failed"; echo -n " ... FAILED"; }
-
- if [ ${GCC_RES} = "ok" ]; then
- GCC_RUN_RES="ok"
-
- echo "*** Run GCC" >> $res
- CMD="ulimit -t ${TIMEOUT_RUN} ; build_gcc/$name.exe > $OUTPUTDIR/result_gcc_$name.txt 2>&1"
- echo "$CMD" >> $res
- /bin/sh -c "$CMD" > $OUTPUTDIR/result_gcc_$name.txt 2>&1 || GCC_RUN_RES="failed"
- fi
-
- if [ ${LINK_RES} = "ok" ]; then
- FIRM_RUN_RES="ok"
-
- echo "*** Run Firm" >> $res
- CMD="ulimit -t ${TIMEOUT_RUN} ; ${EXEC_PREFIX} build_firm/$name.exe > $OUTPUTDIR/result_firm_$name.txt 2>&1"
- echo "$CMD" >> $res
- /bin/sh -c "$CMD" > $OUTPUTDIR/result_firm_$name.txt 2>&1 || { FIRM_RUN_RES="failed"; echo -n " ... FAILED"; }
- fi
-
- if [ ${GCC_RUN_RES} = "ok" -a ${FIRM_RUN_RES} = "ok" ]; then
- DIFF_RES="ok"
-
- echo "*** Compare Results" >> $res
- CMD="diff -u $OUTPUTDIR/result_gcc_$name.txt $OUTPUTDIR/result_firm_$name.txt"
- $CMD > $OUTPUTDIR/result_diff_$name.txt 2>&1 || { DIFF_RES="failed"; echo -n " ... FAILED"; }
- fi
- echo
-
- cat >> $XMLRES << __END__
- <result name="$name">
- <compile>$COMPILE_RES</compile>
- <link>$LINK_RES</link>
- <gcc_compile>$GCC_RES</gcc_compile>
- <gcc_run>$GCC_RUN_RES</gcc_run>
- <firm_run>$FIRM_RUN_RES</firm_run>
- <diff>$DIFF_RES</diff>
- </result>
-__END__
-done
-
-echo "</results>" >> $XMLRES
-
-xsltproc --output $OUTPUTDIR/index.html makehtml.xslt $XMLRES
-
-# maybe execute custom actions after result has been generated
-[ -e after_compile.sh ] && ./after_compile.sh "$OUTPUTDIR"
+++ /dev/null
-#include <stdio.h>
-#include <limits.h>
-
-#define MAX (1 << 10)
-#define TRUNC 0xff
-#define MAX_SHOW TRUNC
-
-void dump_field(short *field, int size, const char *name) {
- int i;
- printf("======== %s : START ========\n", name);
- for(i = 0; i < size; i++){
- printf("data[%i] = %i\n", i, field[i]);
- }
- printf("======== %s : END ========\n", name);
-}
-
-void dequant_h263_inter_c(short *data, const short *coeff, const unsigned int quant) {
- const unsigned short quant_m_2 = quant << 1;
- const unsigned short quant_add = (quant & 1 ? quant : quant - 1);
- int i;
-
- for (i = 0; i < MAX; i++) {
- short acLevel = coeff[i];
-
- if (acLevel == 0) {
- data[i] = 0;
- } else if (acLevel < 0) {
- acLevel = acLevel * quant_m_2 - quant_add;
- data[i] = (acLevel > 2048 ? acLevel : 2048);
- } else {
- acLevel = acLevel * quant_m_2 + quant_add;
- data[i] = (acLevel <= 2047 ? acLevel : 2047);
- }
- }
-}
-
-int main(int argc, char **argv){
- short cur[MAX];
- short ref[MAX];
- int numofruns = 30;
- int i,ii;
-
- if(argc > 1)
- numofruns = atoi(argv[1]);
-
- for (i = 0; i < numofruns; i++){
- /* Reset cache. Alles andere ist unrealistisch. */
- for(ii = 0; ii < MAX; ii++){
- cur[ii] = 0;
- ref[ii] = (ii + i + 3) & TRUNC;
- }
-
- if (i == 0 && argc == 1)
- dump_field(ref, MAX_SHOW, "ref");
-
- dequant_h263_inter_c(cur, ref, 1024 * (i & 0x3));
- }
-
- if (argc == 1)
- dump_field(cur, MAX_SHOW, "cur");
-
- return 0;
-}
+++ /dev/null
-unsigned int MAX_INT = 4294967295;
-
-int main(void) {
- double res = MAX_INT;
- printf("Res: %f\n", res);
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-/*
- * Multiplication test for mul register constraints
- */
-int a = -2, b = 3, c = -4, d = 6, e = -6;
-unsigned ua = 2, ub = 3;
-
-int main()
-{
- int A, B, C;
- unsigned D;
-
- A = b * c;
- B = A * d;
- C = A * e;
- D = ua * ub;
-
- printf("Result: %d %u\n", A+B+C, D);
-
- return 0;
-}
+++ /dev/null
-/* should produce only ONE mul, no conv's */
-#include <stdio.h>
-
-int a = 0x80000000;
-
-int main(void)
-{
- unsigned long long x = 3 * (unsigned long long)a;
- printf("%lld\n", x);
- x = (unsigned long long)a * (unsigned long long)a;
- printf("%lld\n", x);
- return 0;
-}
+++ /dev/null
-/**
- * check all kinds of multiplication with constants
- */
-
-#define test_C(C) \
-int test_##C(int i) { \
- return i * C; \
-}
-#define test_N(C) \
-int test_m##C(int i) { \
- return i * -C; \
-}
-#include "mulconst.h"
-#undef test_C
-#undef test_N
-
-#define test_C(C) printf("%d\n", test_##C(x));
-#define test_N(C) printf("%d\n", test_m##C(x));
-
-int x = 1;
-
-int main() {
-#include "mulconst.h"
- return 0;
-}
+++ /dev/null
-/**
- * check all kinds of multiplication with constants
- */
-test_N(1)
-test_N(2)
-test_N(3)
-test_N(4)
-test_N(5)
-test_N(6)
-test_N(7)
-test_N(8)
-test_N(9)
-test_N(10)
-test_N(11)
-test_N(12)
-test_N(13)
-test_N(14)
-test_N(15)
-test_N(16)
-test_N(17)
-test_N(18)
-test_N(19)
-test_N(20)
-test_C(0)
-test_C(1)
-test_C(2)
-test_C(3)
-test_C(4)
-test_C(5)
-test_C(6)
-test_C(7)
-test_C(8)
-test_C(9)
-test_C(10)
-test_C(11)
-test_C(12)
-test_C(13)
-test_C(14)
-test_C(15)
-test_C(16)
-test_C(17)
-test_C(18)
-test_C(19)
-test_C(20)
-test_C(27)
-test_C(81)
-test_C(1560)
-test_C(46347)
-test_C(348435)
+++ /dev/null
-#include <stdio.h>
-#include <stdlib.h>
-
-typedef int arraya[8][8];
-
-int main()
-{
- int i = 0,j = 0;
- arraya *p;
- p = (arraya*)calloc(1,sizeof(arraya));
- (*p)
- [i]
- [j] = 1;
-
- return 0;
-}
+++ /dev/null
-/*$ -march=pentium3 $*/
-
-int f(int a, int b) {
- return a && b ? 11 : 42;
-}
-
-int x = 2, y = 3;
-
-int main(void) {
- int ret = 23 < f(x,y);
- printf("%d\n", ret);
- return ret;
-}
+++ /dev/null
-#include <stdio.h>
-
-int k = 0;
-
-static void
-send_via_write()
- {
- int r2 = k, fd;
- if ( r2 <= 2147483647 )
- {
- }
- else
- {
- for (;;)
- {
- for (;;)
- {
- r2 = printf( "%d\n", fd );
- if ( r2 < 0 )
- {
- continue;
- }
- if ( r2 != 235 )
- return;
- break;
- }
- }
- }
- }
-
-int main(void) {
- send_via_write();
- return(0);
-}
+++ /dev/null
-#include <stdio.h>
-
-int k = 0;
-
-static void
-send_via_write() {
- int r2 = k;
- if ( r2 <= 2147483647 )
- {
- }
- else
- {
- for (;;)
- {
- for (;;)
- {
- r2 = printf( "%d\n", r2 );
-// if ( r2 < 0 )
- {
- continue;
- }
- if ( r2 != 235 )
- return;
- }
- }
- }
-}
-
-int main()
-{
- send_via_write();
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-#define MAX_OPERANDS 3
-
-typedef unsigned short uint16_t;
-typedef unsigned char uint8_t;
-
-typedef struct ASMInstr {
- uint16_t sym;
- uint8_t op_type[MAX_OPERANDS]; /* see OP_xxx */
-} ASMInstr;
-
-const ASMInstr asm_instrs[] = {
- { 1, { 2, 3 }},
- /* last operation */
- { 0, },
-};
-
-int main()
-{
- int i;
-
- printf("sizeof(asm_instrs[]) = %d\n", sizeof(asm_instrs));
-
-
- for (i = 0; i < sizeof(asm_instrs)/sizeof(asm_instrs[0]); ++i) {
- printf("%d.: %d { %d %d %d }\n", i,
- asm_instrs[i].sym,
- asm_instrs[i].op_type[0],
- asm_instrs[i].op_type[1],
- asm_instrs[i].op_type[2]
- );
- }
-
- return 0;
-}
+++ /dev/null
-#include <stdlib.h>
-#include <stdio.h>
-
-static int * const a = (int *)0x10;
-static int * const b = (int *)0x20;
-
-int main() {
- printf("%p\n", b - a);
- return 0;
-}
+++ /dev/null
-struct foo {
- int bar;
-};
-
-struct foo *curcmd;
-int tmps_max;
-int tmps_base;
-
-#define CF_FLIP 020000
-#define CF_COND 01000
-
-int main() {
- struct foo *cmd;
- int cmdflags;
-
- if (cmdflags & CF_COND) {
-
- goto maybe;
- flipmaybe:
- if (cmdflags) {
- while (tmps_max > tmps_base) { /* clean up after last eval */
- }
- }
- maybe:
- curcmd = cmd;
- }
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-#define tname(x) x##long
-#define T long
-#include "optest.h"
-
-#undef tname
-#undef T
-#define tname(x) x##int
-#define T int
-#include "optest.h"
-
-#undef tname
-#undef T
-#define tname(x) x##short
-#define T short
-#include "optest.h"
-
-#undef tname
-#undef T
-#define tname(x) x##char
-#define T char
-#include "optest.h"
-
-#define TEST_UNSIGNED
-
-#undef tname
-#undef T
-#define tname(x) x##unsigned_long
-#define T unsigned long
-#include "optest.h"
-
-#undef tname
-#undef T
-#define tname(x) x##unsigned_int
-#define T unsigned int
-#include "optest.h"
-
-#undef tname
-#undef T
-#define tname(x) x##unsigned_short
-#define T unsigned short
-#include "optest.h"
-
-#undef tname
-#undef T
-#define tname(x) x##unsigned_char
-#define T unsigned char
-#include "optest.h"
-
-#if 0
-#undef tname
-#undef T
-#define tname(x) x##unsigned_long_long
-#define T unsigned long long
-#include "optest.h"
-
-#undef TEST_UNSIGNED
-
-#undef tname
-#undef T
-#define tname(x) x##long_long
-#define T long long
-#include "optest.h"
-#endif
-
-int main(int argc, char *argv[]) {
- test_long();
- test_int();
- test_short();
- test_char();
- test_unsigned_long();
- test_unsigned_int();
- test_unsigned_short();
- test_unsigned_char();
-#if 0
- test_unsigned_long_long();
- test_long_long();
-#endif
- return 0;
-}
+++ /dev/null
-#include <string.h>
-
-#ifndef TESTANZ
-#define TESTANZ 21
-#define IMM 23
-#define IMM_SHIFT 4
-#define test16_1 42
-#define test16_2 11
-#define test16_shift 7
-#define test32_1 (T) 0x001200AB
-#define test32_2 (T) 0x00341501
-#define test32_shift 5
-#define test32_s 7
-#endif
-
-T tname(test_add_) (T a, T b) {
- return a+b;
-}
-
-T tname(test_addi_) (T a) {
- return a+IMM;
-}
-
-T tname(test_sub_) (T a, T b) {
- return a-b;
-}
-
-T tname(test_subi_) (T a) {
- return a-IMM;
-}
-
-T tname(test_subfi_) (T a) {
- return IMM-a;
-}
-
-T tname(test_mul_) (T a, T b) {
- return a*b;
-}
-
-T tname(test_muli_) (T a) {
- return a*IMM;
-}
-
-T tname(test_div_) (T a, T b) {
- return a/b;
-}
-
-T tname(test_divi_) (T a) {
- return a/IMM;
-}
-
-#ifndef TEST_UNSIGNED
-T tname(test_abs_) (T a) {
- return a < 0 ? -a : a;
-}
-
-T tname(test_neg_) (T a) {
- return -a;
-}
-#endif
-
-#ifndef TEST_FLOAT
-T tname(test_shl_) (T a, T b) {
- return a<<b;
-}
-
-T tname(test_shli_) (T a) {
- return a<<IMM_SHIFT;
-}
-
-T tname(test_shr_) (T a, T b) {
- return a>>b;
-}
-
-T tname(test_shri_) (T a) {
- return a>>IMM_SHIFT;
-}
-
-T tname(test_mod_) (T a, T b) {
- return a%b;
-}
-#endif
-
-T tname(test_cmp_) (T a, T b) {
- return (a>b) ? 1 : 0;
-}
-
-T tname(test_cmpi_) (T a) {
- return (a>IMM) ? 1 : 0;
-}
-
-T tname(res16_) [TESTANZ];
-T tname(res32_) [TESTANZ];
-
-void tname(test_) () {
- int i;
- T *res16 = tname(res16_);
- memset(res16, 0, TESTANZ * sizeof(res16[0]));
- T *res32 = tname(res32_);
- memset(res32, 0, TESTANZ * sizeof(res32[0]));
-
- res16[ 0] = tname(test_add_) (test16_1, test16_2);
- res16[ 1] = tname(test_sub_) (test16_1, test16_2);
- res16[ 2] = tname(test_mul_) (test16_1, test16_2);
- res16[ 3] = tname(test_div_) (test16_1, test16_2);
-#ifndef TEST_FLOAT
- res16[ 4] = tname(test_shl_) (test16_1, test16_shift);
- res16[ 5] = tname(test_shr_) (test16_1, test16_shift);
- res16[ 6] = tname(test_mod_) (test16_1, test16_2);
-#endif
- res16[ 7] = tname(test_div_) (test16_1, test16_2);
- res16[ 8] = tname(test_cmp_) (test16_1, test16_2);
- res16[ 9] = tname(test_addi_) (test16_1);
- res16[10] = tname(test_subi_) (test16_1);
- res16[11] = tname(test_subfi_)(test16_1);
- res16[12] = tname(test_muli_) (test16_1);
- res16[13] = tname(test_divi_) (test16_1);
-#ifndef TEST_FLOAT
- res16[14] = tname(test_shli_) (test16_1);
- res16[15] = tname(test_shri_) (test16_1);
-#endif
- res16[16] = tname(test_cmpi_) (test16_1);
-#ifndef TEST_UNSIGNED
- res16[17] = tname(test_neg_) (test16_1);
- res16[18] = tname(test_neg_) (-test16_1);
- res16[19] = tname(test_abs_) (test16_1);
- res16[20] = tname(test_abs_) (-test16_1);
-#endif
-
- res32[ 0] = tname(test_add_) (test32_1, test32_2);
- res32[ 1] = tname(test_sub_) (test32_1, test32_2);
- res32[ 2] = tname(test_mul_) (test32_1, test32_2);
- res32[ 3] = tname(test_div_) (test32_1, test32_2);
-#ifndef TEST_FLOAT
- res32[ 4] = tname(test_shl_) (test32_1, test32_shift);
- res32[ 5] = tname(test_shr_) (test32_1, test32_shift);
- res32[ 6] = tname(test_mod_) (test32_1, test32_2);
-#endif
- res32[ 7] = tname(test_div_) (test32_1, test32_2);
- res32[ 8] = tname(test_cmp_) (test32_1, test32_2);
- res32[ 9] = tname(test_addi_) (test32_1);
- res32[10] = tname(test_subi_) (test32_1);
- res32[11] = tname(test_subfi_)(test32_1);
- res32[12] = tname(test_muli_) (test32_1);
- res32[13] = tname(test_divi_) (test32_1);
-#ifndef TEST_FLOAT
- res32[14] = tname(test_shli_) (test32_1);
- res32[15] = tname(test_shri_) (test32_1);
-#endif
- res32[16] = tname(test_cmpi_) (test32_1);
-#ifndef TEST_UNSIGNED
- res32[17] = tname(test_neg_) (test32_1);
- res32[18] = tname(test_neg_) (-test32_1);
- res32[19] = tname(test_abs_) (test32_1);
- res32[20] = tname(test_abs_) (-test32_1);
-#endif
-
- printf("Result for %s\n", __PRETTY_FUNCTION__);
- for (i=0; i<TESTANZ; i++) {
-#ifndef TEST_FLOAT
- printf("res16[%d] = %d\n", i, res16[i]);
- printf("res32[%d] = %d\n", i, res32[i]);
-#else
- printf("res16[%d] = %f\n", i, res16[i]);
- printf("res32[%d] = %f\n", i, res32[i]);
-#endif
- }
-}
+++ /dev/null
-#include <stdio.h>
-
-#define TEST_FLOAT
-
-#define tname(x) x##float
-#define T float
-#include "optest.h"
-
-#undef tname
-#undef T
-#define tname(x) x##double
-#define T double
-#include "optest.h"
-
-#if 0
-#undef tname
-#undef T
-#define tname(x) x##long_double
-#define T long_double
-#include "optest.h"
-#endif
-
-int main(int argc, char *argv[]) {
- test_float();
- test_double();
-#if 0
- test_long_double();
-#endif
- return 0;
-}
+++ /dev/null
-int A;
-
-int test(int a) {
- if (a == 23)
- goto end;
- while (A != 0) {
- A = A * a;
- }
-end:
- /* return should be padded by using ret $0 */
- return a;
-}
-
-int main(int argc, char *argv[]) {
- return 23 != test(23);
-}
+++ /dev/null
-char *block;
-
-int k3_3(int i1, int i2, int i3) {
- char a1, a2, a3;
- char b1, b2, b3;
- char c1, c2, c3;
-
- a1 = block[++i1];
- a2 = block[++i2];
- a3 = block[++i3];
-
- b1 = block[++i1];
- b2 = block[++i2];
- b3 = block[++i3];
-
- c1 = block[++i1];
- c2 = block[++i2];
- c3 = block[++i3];
-
- if (a1 != a2)
- return a3;
- if (b1 != b2)
- return b3;
- if (c1 != c2)
- return c3;
-
- return 0;
-}
-
-int main(int argc, char **argv) {
- return 0;
-}
+++ /dev/null
-/**
- * This test case should provoke incompatible heuristical decision of the
- * PBQP solver, which lead to infinity cost, i.e. no solution of the PBQP could
- * found.
- *
- * It is necessary to manipulation some cost vectors to let the PBQP solver
- * "crash". More details are shown below.
- *
- * This also seems more a missing feature of the PBQP solver than a counter
- * example against the PBQP approach for instruction selection.
- */
-
-unsigned *block;
-unsigned *block1, *block2, *block3, *block4, *block5, *block6;
-unsigned *block7, *block8,*block9,*block10,*block11;
-volatile unsigned arr[100];
-unsigned b = 3008;
-unsigned g1,g2,g3;
-unsigned g4,g5,g6;
-unsigned g7,g8;
-unsigned h1,h2,h3;
-unsigned h4,h5,h6;
-unsigned h7,h8,h9;
-unsigned k1,k2,k3;
-unsigned k4,k5,k6;
-unsigned kb1,kb2,kb3;
-unsigned kc1,kc2,kc3;
-unsigned kd1,kd2,kd3;
-unsigned ke1,ke2,ke3;
-
-unsigned k3_3(char* base, unsigned i1, unsigned i2, unsigned i3, unsigned k1, unsigned k2, unsigned k3)
-{
- char a1, a2, a3;
- char b1, b2, b3;
- char c1, c2, c3;
-
- a1 = i1 + k1;
- a2 = base[i2 + k1];
- a3 = base[i3 + k1];
-
- b1 = i1 + k2;
- b2 = base[i2 + k2];
- b3 = base[i3 + k2];
-
- c1 = i1 + k3;
- c2 = base[i2 + k3];
- c3 = base[i3 + k3];
-
- if (a1 != a2)
- return a3;
- if (b1 != b2)
- return b3;
- if (c1 != c2)
- return c3;
-
- return 0;
-}
-
-unsigned k3_3_2(char* base, int i1, int i2, int i3, int k1, int k2, int k3)
-{
- char a1, a2, a3;
- char b1, b2, b3;
- char c1, c2, c3;
-
- a1 = base[i1 + k1];
- a2 = base[i2 + k1];
- a3 = base[i3 + k1];
-
- b1 = base[i1 + k2];
- b2 = base[i2 + k2];
- b3 = base[i3 + k2];
-
- c1 = base[i1 + k3];
- c2 = base[i2 + k3];
- c3 = base[i3 + k3];
-
- if (a1 != a2)
- return a3;
- if (b1 != b2)
- return b3;
- if (c1 != c2)
- return c3;
-
- return 0;
-}
-
-unsigned k3_3_am(char* base, unsigned i1, unsigned i2, unsigned i3, unsigned k1, unsigned k2, unsigned k3)
-{
- char a1, a2, a3;
- char b1, b2, b3;
- char c1, c2, c3;
-
- a1 = base[i1 + k1];
- a2 = base[i2 + k1];
- a3 = base[i3 + k1];
-
- b1 = base[i1 + k2];
- b2 = base[i2 + k2];
- b3 = base[i3 + k2];
-
- c1 = base[i1 + k3];
- c2 = base[i2 + k3];
- c3 = base[i3 + k3];
-
- if (a1 != a2)
- return a3;
- if (b1 != b2)
- return b3;
- if (c1 != c2)
- return c3;
-
- return 0;
-}
-
-void full_am(unsigned base, int index, unsigned base2, int index2, unsigned base3, int index3, unsigned base4, int index4, unsigned base5, int index5)
-{
- /*
- * This is the core of this example.
- * The following line can be done with one instruction
- * (add with address mode) on x86.
- * We provoke four heuristical decision on nodes of this address mode
- * pattern. The mean idea is that the root (the add node) choose this
- * pattern, but the decision on the shift const forbid these.
- * To achieve this you have to manipulate the cost of the shift const by
- * hand!
- * The other two heuristical decision ensure, that the two heuristical
- * decision above are separated, i.e. there are at least two irreducible
- * nodes between them.
- */
- unsigned ca = arr[index] + base;
-
- /*
- * The following function ensure irreducible users of given nodes.
- * All of these function have to be inlined.
- */
-
- /* users for shift const */
- b = k3_3_am(block, h1, h2, h3, 2, 3, 4);
- b = k3_3_am(block, h4, h5, h6, 2, 5, 6);
- b = k3_3_am(block, h7, h8, h9, 2, 7, 8);
-
- /* users for symconst */
- unsigned cb = arr[index2] + base2;
- b = k3_3(block1, cb, kb1, kb2, 101, 102, 103);
- unsigned cc = arr[index3] + base3;
- b = k3_3(block2, cc, kc1, kc2, 111, 112, 113);
- unsigned cd = arr[index4] + base4;
- b = k3_3(block3, cd, kd1, kd2, 121, 122, 123);
- unsigned ce = arr[index5] + base5;
- b = k3_3(block4, ce, ke1, ke2, 131, 132, 133);
-
- /* users for offset */
- b = k3_3_2(block5, 4 * index, g1, g2, 31, 32, 33);
- b = k3_3_2(block6, 4 * index, g3, g4, 34, 35, 36);
- b = k3_3_2(block7, 4 * index, g5, g6, 37, 38, 39);
- b = k3_3_2(block8, 4 * index, g7, g8, 40, 41, 42);
-
- /* users for computed value */
- b = k3_3(block9, ca, k1, k2, 13, 14, 15);
- b = k3_3(block10, ca, k3, k4, 16, 17, 18);
- b = k3_3(block11, ca, k5, k6, 19, 20, 21);
-}
-
-int main(int argc, char **argv) {
- return 0;
-}
+++ /dev/null
-/**
- * This test case shows that it's not possible to find a PBQP solution for
- * arbitrary pattern sets.
- *
- * You also have to use the following compiler flags:
- * -O3 -fno-reassociation
- *
- * Because of the disabled reassociation you have to add the following rule:
- * - Add(Add(Shl(ShiftConst(), index=IR_node()), imm=Const()), base=IR_node())
- *
- * To get infinity costs you have to remove the following Lea rules:
- * - Add(Shl(ShiftConst(), index=IR_node()), imm=Const())
- * - Add(Shl(ShiftConst(), index=IR_node()), base=IR_node())
- *
- * For more details take a look at the diamond function.
- */
-unsigned a;
-unsigned b;
-unsigned *gi1, gi2, gi3, gi4, gi5;
-unsigned *gi101, gi102, gi103, gi104, gi105;
-unsigned *gi201, gi202, gi203, gi204, gi205;
-unsigned *gi211, gi212, gi213, gi214, gi215;
-unsigned *gi301, gi302, gi303, gi304, gi305;
-unsigned *gi311, gi312, gi313, gi314, gi315;
-unsigned *gi401, gi402, gi403, gi404, gi405;
-unsigned *gi411, gi412, gi413, gi414, gi415;
-unsigned *gi501, gi502, gi503, gi504, gi505;
-unsigned *gi511, gi512, gi513, gi514, gi515;
-unsigned *gi601, gi602, gi603, gi604, gi605;
-unsigned *gi611, gi612, gi613, gi614, gi615;
-unsigned *gi701, gi702, gi703, gi704, gi705;
-unsigned *gi711, gi712, gi713, gi714, gi715;
-unsigned *gi801, gi802, gi803, gi804, gi805;
-unsigned *gi811, gi812, gi813, gi814, gi815;
-unsigned **gp;
-unsigned use;
-
-int main(int argc, char **argv)
-{
- return 0;
-}
-
-unsigned add_1_shift_users(unsigned i1, unsigned i2, unsigned i3,
- char *k1, char *k2, char *k3,
- unsigned **gp1, unsigned **gp2, unsigned **gp3, unsigned **gp4,
- unsigned **gp5, unsigned **gp6, unsigned **gp7, unsigned **gp8,
- unsigned **gp9,
- const int c1, const int c2, const int c3)
-{
- unsigned tmp1 = i1 + c1;
- unsigned tmp2 = (i2 << 3) + c2;
- unsigned tmp3 = (i3 << 3) + c3;
-
- *gp1 = tmp1 + k1;
- *gp2 = tmp2 + k1;
- *gp3 = tmp3 + k1;
-
- *gp4 = tmp1 + k2;
- *gp5 = tmp2 + k2;
- *gp6 = tmp3 + k2;
-
- *gp7 = tmp1 + k3;
- *gp8 = tmp2 + k3;
- *gp9 = tmp3 + k3;
-
- return 0;
-}
-
-unsigned add_3_add_const_shift_users(unsigned i1, unsigned i2, unsigned i3,
- char *k1, char *k2, char *k3,
- unsigned **gp1, unsigned **gp2, unsigned **gp3, unsigned **gp4,
- unsigned **gp5, unsigned **gp6, unsigned **gp7, unsigned **gp8,
- unsigned **gp9,
- const int c1, const int c2)
-{
- unsigned tmp2 = (i2 << 3) + c1;
- unsigned tmp3 = (i3 << 3) + c2;
-
- *gp1 = i1 + k1;
- *gp2 = tmp2 + k1;
- *gp3 = tmp3 + k1;
-
- *gp4 = i1 + k2;
- *gp5 = tmp2 + k2;
- *gp6 = tmp3 + k2;
-
- *gp7 = i1 + k3;
- *gp8 = tmp2 + k3;
- *gp9 = tmp3 + k3;
-
- return 0;
-}
-
-void diamond(void)
-{
- /*
- * This is the basic structure.
- *
- * as
- * / \
- * asb asc
- * \ /
- * sum
- *
- * The basic idea is to make a heuristical "consume me" decision for "as".
- * If "asb" and "asc" have no terminal rules which consumes "as", they also
- * have to be consumed. Therefore "sum" has to consume both paths up to
- * "as", which isn't possible.
- */
- unsigned as = a << 3;
- unsigned asb = as + 123235;
- unsigned asc = as + 235346;
- unsigned sum = asb + asc;
-
- b = sum;
-
- /* Add 3 users for asb. */
- use = add_3_add_const_shift_users(asb, gi1, gi2,
- &gi3, &gi4, &gi5,
- &gp[0], &gp[1], &gp[2], &gp[3], &gp[4], &gp[5], &gp[6], &gp[7], &gp[8],
- 7, 8);
-
- /* Add 3 users for asc. */
- use = add_3_add_const_shift_users(asc, gi101, gi102,
- &gi103, &gi104, &gi105,
- &gp[100], &gp[101], &gp[102], &gp[103], &gp[104], &gp[105], &gp[106], &gp[107], &gp[108],
- 107, 108);
-
- /* Add 4 users for as. */
- use = add_1_shift_users(as, gi201, gi202,
- &gi203, &gi204, &gi205,
- &gp[200], &gp[201], &gp[202], &gp[203], &gp[204], &gp[205], &gp[206], &gp[207], &gp[208],
- 200, 201, 202);
- use = add_1_shift_users(as, gi301, gi302,
- &gi303, &gi304, &gi305,
- &gp[300], &gp[301], &gp[302], &gp[303], &gp[304], &gp[305], &gp[306], &gp[307], &gp[308],
- 300, 301, 302);
- use = add_1_shift_users(as, gi401, gi402,
- &gi403, &gi404, &gi405,
- &gp[400], &gp[401], &gp[402], &gp[403], &gp[404], &gp[405], &gp[406], &gp[407], &gp[408],
- 400, 401, 402);
- use = add_1_shift_users(as, gi501, gi502,
- &gi503, &gi504, &gi505,
- &gp[500], &gp[501], &gp[502], &gp[503], &gp[504], &gp[505], &gp[506], &gp[507], &gp[508],
- 500, 501, 502);
-}
+++ /dev/null
-#define GAMMEL
-
-double M;
-
-int main(void)
-{
- int j;
-#ifdef GAMMEL
- int Ke[1], Me[42], Ce[42];
-#else
- int Me[42], Ce[42];
-#endif
-
- while(!j)
- for (j = 0; j < 1; j++)
- M = Me[j] + Me[j + 1] + Me[j + 2] + Ce[j] + Ce[j + 1] + Ce[j + 2];
-
- printf("done.\n");
-
- return 0;
-}
+++ /dev/null
-static int A;
-
-/* This function produces unnecessary Phi nodes due to the way
- * x is assigned. Note: This is not a bug, its by the Phi construction algorithm. */
-void test(int l, int m) {
- int i, x = m;
-
- for (i = 0; i < l; ++i) {
- A = x;
-
- if (l > 5)
- x = m;
- }
-}
-
-int main()
-{
- test(4,5);
- printf("A = %d\n", A);
- return 0;
-}
+++ /dev/null
-static void postinc_break(int *a, int *b) {
- // assumes sizeof(int) == sizeof(int*)
- *a = b+1;
- *b = a+1;
-}
-
-int main(void) {
- int a, b;
- postinc_break(&a, &b);
- printf("%d\n", a-b);
- return 0;
-}
+++ /dev/null
-int func (int a, int b) {
- return a == b;
-}
-
-double func2(double a, double b) {
- return a != b ? a : b;
-}
-
-int func3(double a, double b) {
- return a != b;
-}
-
-int func4(double a, double b, int c, int d) {
- return a > b ? c : d;
-}
-
-double func5(double a, double b, int c, int d) {
- return c < d ? a : b;
-}
-
-int func6(double a, double b) {
- return a == 0.0 && b + 1.0 < 10.0;
-}
-
-int main()
-{
- return 0;
-}
+++ /dev/null
-#include <assert.h>
-
-char* ptr(void)
-{
- return (char*) 123;
-}
-
-int main()
-{
- printf("Int: %d\n", (int) ptr());
- return 0;
-}
+++ /dev/null
-/*
- * Project: GCC-firm
- * File name: test/Queens.c
- * Purpose: solve the queens problem
- * Author: Markus Armbruster (in sather-k)
- * Modified by: Michael Beck (for GCC-firm)
- * Created: XX.11.2001
- * CVS-ID: $Id$
- * Copyright: (c) 2001 Universitaet Karlsruhe
- * Licence:
- */
-/*
- -- The notorious n-queens problem (C.F. Gauss, 1850)
- -- Copyright (C) 1996 Markus Armbruster
-*/
-
-#include <stdlib.h>
-#include <stdio.h>
-
-
-typedef int boolean;
-
-#define true 1
-#define false 0
-
-//static int *row;
-// queen in column c is at row[c]
-
-static int myabs(int i) {
- if(0 > i)
- i = -i;
- return(i);
-}
-
-static inline boolean place_ok (int i, const int *r, int ri) {
- // return whether queen in column i is
- // not in check from queens left of it
- int j = 0;
- boolean res;
-
-#if 0
- if(0 >= i)
- return true;
-
- do {
- int rj = r[j];
- if ((rj == ri) || ((myabs(ri-rj)) == (i-j))) {
- res = false;
- return(res);
- }
- j = j+1;
- } while(j < i);
-
- res = true;
- return(res);
-#else
- while (j < i) {
- int rj = r[j];
- if ((rj == ri) || ((myabs(ri-rj)) == (i-j))) {
- res = false;
- return(res);
- }
- j = j+1;
- }
-
- res = true;
- return(res);
-#endif
-}
-
-int solve (int n) {
- // return the number of solutions to the n-queens problem
- int c = 0;
- int res = 0;
- int *row;
-
- row = malloc(sizeof(*row) * n);
- row[0] = -1;
- while (c >= 0) {
- int rc = row[c];
-
- do {
- rc++;
- } while ((rc < n) && (!place_ok(c, row, rc)));
-
- if (rc < n) { // successfully placed at (c,row[c])
- row[c] = rc;
-
- if (c == n-1)
- res = res+1;
- else {
- c = c+1;
- row[c] = -1;
- }
- continue;
- }
-
- row[c] = rc;
- c = c-1;
- }
- free(row);
-
- return(res);
-}
-
-static void usage (const char *progname) {
- printf("usage: %s\n", progname);
-}
-
-
-int main (int argc, char *argv[]) {
- int n;
-
- switch (argc) {
- case 1:
- n = 8;
- break;
- case 2:
- n = atoi(argv[1]);
- break;
- default:
- usage("queens");
- return 0;
- }
- printf("The %d-queens problem has %d solutions.\n", n, solve(n));
-
- return 0;
-}
+++ /dev/null
-int freq_tab[MAXPRINTABLE][MAXPRINTABLE] = {
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,332,25,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-1082,0,0,0,0,0,2,1174,493,0,0,0,0,17,0,0,0,51,48,29,1,1,1,1,1,1,0,0,0,0,0,0,
-0,13558,4764,2161,1737,907,3159,1683,5183,9882,146,442,2003,3755,3133,4188,1430,83,774,4976,15912,816,224,10094,0,2597,3,6246,0,0,0,0,
-0,1938,810,837,594,312,687,377,1107,652,37,170,468,881,460,647,592,51,296,1270,2699,185,122,1102,0,446,0,0,626,0,0,4,
-0,0,0,0,0,0,0,0,0,85336,47895,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-309,0,0,9,1,0,2,328,1,0,0,0,0,5,34,2,0,2,2,1,0,0,0,0,0,0,0,0,0,0,0,0,
-0,3697,2611,3554,2217,804,2438,1312,1855,989,487,1732,2207,2400,530,1482,2838,520,1039,4077,2563,212,568,1063,63,245,1,2,0,0,0,0,
-0,12,3,3,0,0,5,1,12,3,0,0,0,3,1,7,2,0,5,8,14,1,0,3,0,1,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,10,15,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-16269,0,1,0,1,0,70,2867,181,0,0,0,0,4,3,4,0,6,4,2,1,1,7,0,2,0,5,0,0,1,0,0,
-0,3901,2838,4171,1689,2319,1943,2581,3443,19536,1185,908,3203,3037,992,2406,3011,317,1788,3595,3268,96,1630,2352,41,873,0,17,2,13,0,0,
-0,66153,36457,24728,25199,11137,30305,15793,53432,33915,1673,6956,23787,48138,22792,35659,20512,1688,10990,55787,106335,8005,4293,47563,0,22389,53,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,5061,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-3940,1,0,0,0,0,0,198,0,0,0,0,0,139,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,4,3,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-3,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,3,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,69,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,1,697,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-2325,12,0,0,0,0,0,26,0,0,0,0,7,61,0,0,0,0,0,0,0,0,0,0,0,0,4,4,0,0,0,44,
-0,121,58,43,25,14,106,81,86,133,9,3,53,48,41,78,33,1,17,241,905,3,10,128,0,24,17,0,0,14,0,0,
-0,56,36,69,5785,1187,48,123,36,28,3,4,2650,69,113,31,26,3,152,8938,2414,4,21,27,0,14,2,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,4,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,19,26,39,19,11,116,43,23,3,4,21,25,41,10,11,31,8,9,151,39,0,7,12,0,5,0,0,0,0,0,0,
-0,3,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,43,615,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-16,0,0,0,0,0,0,0,0,0,0,0,5,0,1,0,0,0,0,0,0,0,0,0,0,0,1,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,7,24160,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-65505,0,0,0,0,0,0,372,0,0,0,0,0,845,3,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,1186,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-10,0,0,0,0,0,0,27,0,0,0,0,1,2269,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,12,31,27,19,4,16,31,41,62,71,2,16,42,9,62,15,1,11,40,15,5,4,25,0,6,0,0,0,0,0,0,
-0,287,504,301,467,432,327,172,381,82,30,50,280,498,253,85,265,13,141,473,366,36,62,347,0,45,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,7,30574,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-7080,0,0,0,0,0,0,453,0,1,0,0,7,56,0,0,2,2,0,0,0,2,0,0,0,0,0,1,0,0,0,0,
-0,2,2,0,0,0,0,1,0,2,0,0,0,0,0,0,0,0,0,18,4,0,0,0,0,0,0,0,2,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,4,0,0,0,2,0,0,0,0,0,3,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,2,0,0,0,0,6,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,6,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,3,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-50,0,0,0,0,0,0,0,0,0,0,0,0,6,1,0,3,1,1,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,1,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-49,0,0,0,0,0,0,0,0,0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,3,1,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-29,0,0,0,0,0,0,0,0,0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,2,0,0,0,0,0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,3,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,2,0,0,0,0,2,0,0,0,0,0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,5,6694,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-7757,0,0,0,0,0,0,101,0,667,0,0,0,84,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,2,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,7551,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-9376,0,0,0,0,0,0,79,0,0,0,0,0,34,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-1,0,0,0,1,0,0,0,0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,7775,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-2715,0,0,0,0,0,0,72,0,0,0,0,0,47,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,3036,103,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-2178,1,0,0,0,0,0,59,0,0,0,0,194,7,3,0,0,0,0,0,0,0,0,0,0,0,4,4,0,0,0,0,
-0,72,524,1681,848,535,665,893,7,280,66,45,2753,1284,5204,0,389,92,5550,1355,1606,988,389,20,72,76,11,0,0,249,0,3,
-0,26,135,177,183,3,111,227,151,11,65,0,1063,187,8942,0,155,9,601,1952,577,110,17,189,0,682,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,16,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-10,0,0,0,0,0,0,0,0,0,0,0,2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,1119,30,0,0,1890,0,0,19,574,1,0,111,0,0,626,0,0,669,6,1,587,0,7,0,284,0,0,0,0,0,0,
-0,427,0,0,0,1811,0,0,0,200,0,0,158,0,0,458,0,0,583,0,0,2841,0,0,0,834,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,33,3,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-4,0,0,0,0,0,0,4,0,4,0,0,1,1,2,0,0,0,0,0,0,0,0,0,0,0,0,1,0,0,0,0,
-0,1909,269,21,92,3327,3,0,1810,786,0,1004,1225,6,0,1104,0,1,373,0,1123,789,8,0,40,198,0,0,0,2,0,0,
-0,1712,0,0,0,76,0,0,513,312,0,0,778,0,2,1960,0,0,233,0,0,138,0,0,0,68,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,1623,39,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-802,0,0,0,0,0,0,9,0,0,0,0,123,15,2,0,0,0,0,0,0,0,0,0,0,0,27,2,0,0,0,0,
-0,563,0,1,12,1637,44,148,0,1280,0,0,10,107,2,1316,3,0,964,122,0,1064,12,220,0,347,0,0,0,114,0,2,
-0,245,0,0,0,586,0,0,0,668,0,0,0,0,0,1003,0,0,221,0,0,371,0,4,0,5,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,2721,177,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-2125,0,0,0,0,0,0,46,0,0,0,0,170,30,9,0,0,0,0,0,0,0,0,0,0,0,38,0,0,0,0,0,
-0,779,186,188,1190,784,18,162,4,114,0,5,2564,842,5806,971,297,7,4116,4062,2218,376,142,205,167,428,2,0,0,137,0,0,
-0,178,2,6,288,0,3,96,0,67,0,0,94,63,2635,1,55,3,125,29,27,21,344,0,2191,5,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,602,23,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-1066,0,0,0,0,0,0,2,0,0,0,0,23,1,1,0,0,0,0,0,0,0,0,0,0,0,5,1,0,0,0,0,
-0,647,0,0,0,439,962,0,0,119,0,0,253,0,0,710,0,0,268,0,35,14,0,0,0,3,0,0,0,24,0,0,
-0,724,0,0,0,193,0,0,0,1300,0,0,246,0,0,2445,0,0,1190,0,0,80,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,204,26,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-1802,0,0,0,0,0,0,9,0,0,0,0,12,10,16,0,0,0,0,0,0,0,0,0,0,0,3,0,0,0,0,0,
-0,718,189,0,0,855,0,11,410,55,0,0,682,2,66,693,0,0,409,109,2,346,0,0,0,2,0,0,0,11,0,0,
-0,230,0,0,0,602,0,0,58,392,0,0,205,0,2,2065,0,0,492,0,0,101,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,804,31,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-206,0,0,0,0,0,0,3,0,0,0,0,53,2,3,0,0,0,0,0,0,0,0,0,0,0,9,1,0,0,0,0,
-0,2020,59,0,0,2804,2,0,0,744,0,0,3,38,271,850,1,0,73,87,72,560,0,6,0,139,0,0,0,57,0,0,
-0,1821,0,0,0,3488,0,0,0,666,0,0,0,0,0,1673,0,0,0,0,0,191,0,0,0,29,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,1109,1063,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-19729,9,0,0,0,0,0,1949,0,0,0,0,404,2,195,0,0,0,0,0,0,0,0,0,0,0,31,59,0,0,0,31,
-0,2774,122,2002,547,379,144,247,2,1816,0,34,1240,768,5766,3087,336,0,936,1560,684,2234,846,24,93,0,179,0,0,16,0,0,
-0,69,0,5,7,0,1535,2,0,0,0,0,45,96,1508,3,2,0,63,940,982,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,179,0,0,0,42,0,0,0,0,0,0,0,0,0,353,0,0,0,0,0,331,0,0,0,0,0,0,0,0,0,0,
-0,142,0,0,0,183,0,0,0,2,0,0,0,0,0,435,0,0,0,0,0,328,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,1077,2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-288,0,0,0,0,0,0,7,0,0,0,0,92,11,4,0,0,0,0,0,0,0,0,0,0,0,23,3,0,0,0,0,
-0,235,0,0,0,1056,1,0,1,2102,0,0,152,0,9,0,0,0,1,9,1,0,0,2,0,3,0,0,0,53,0,0,
-0,161,0,0,0,150,0,0,0,355,0,0,0,0,237,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,636,34,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-338,0,0,0,0,0,0,29,0,0,0,0,57,11,6,0,0,0,0,0,0,0,0,0,0,0,11,1,0,0,0,0,
-0,2648,207,294,163,3422,39,6,0,2718,0,270,1857,56,5,2483,187,0,0,633,164,1367,219,1,30,558,0,0,0,51,0,0,
-0,605,0,0,0,1322,0,0,0,471,0,0,1,0,0,1905,0,0,0,0,0,295,0,0,0,62,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,448,14,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-58,0,0,0,0,0,0,0,0,0,0,0,44,0,6,0,0,0,0,0,0,0,0,0,0,0,6,1,0,0,0,0,
-0,1972,315,0,0,1361,0,0,0,1534,0,0,409,21,144,1310,302,0,1,33,0,255,0,26,0,13,0,0,0,29,0,0,
-0,2185,0,0,0,772,0,0,0,427,0,0,0,0,0,856,0,0,0,0,0,468,0,0,0,1746,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,1995,140,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-940,0,0,0,0,0,0,14,0,0,0,0,149,13,4,0,0,0,0,0,0,0,0,0,0,0,15,5,0,0,0,0,
-0,1759,48,1688,2027,2539,7,2691,8,1816,3,18,44,33,210,994,2,54,1164,551,2454,415,91,65,0,519,116,0,0,143,0,0,
-0,639,0,0,0,375,0,0,0,70,0,0,0,0,0,3030,0,0,0,0,0,142,0,0,0,22,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,4275,33,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-1671,22,0,0,0,0,0,92,0,0,0,0,1390,2,8,0,0,0,0,0,0,0,0,0,0,0,9,3,0,0,0,1,
-0,73,419,459,154,15,1147,219,265,282,2,162,2490,1110,3740,77,537,0,3118,963,1099,1126,128,370,92,118,5,0,0,252,0,0,
-0,1,35,48,11,0,1168,0,25,0,0,0,122,7,516,0,71,0,792,12,64,568,29,12,30,1,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,91,26,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-83,0,0,0,0,0,0,3,0,0,0,0,6,3,0,0,0,0,0,0,0,0,0,0,0,0,3,0,0,0,0,0,
-0,1231,0,21,0,1338,0,0,899,352,0,1,96,0,0,707,90,0,897,45,99,392,0,0,0,6,0,0,0,1,0,0,
-0,763,0,0,0,548,0,0,142,178,0,0,278,0,0,541,0,0,971,2,5,172,0,0,0,77,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,933,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,164,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,1899,83,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-808,0,0,0,0,0,0,42,0,0,0,0,181,19,8,0,0,0,0,0,0,0,0,0,0,0,27,1,0,0,0,0,
-0,1829,214,483,2251,2026,89,415,2,3501,2,634,539,306,402,2938,17,2,201,477,975,950,93,248,0,1432,0,0,0,140,0,0,
-0,126,0,0,0,944,0,0,13,341,0,0,0,0,0,985,0,0,0,0,0,106,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,5987,299,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-1773,1,0,0,0,0,0,21,0,1,0,0,509,8,29,0,0,0,0,0,0,0,0,0,0,0,42,11,0,2,0,0,
-0,1407,153,1030,193,966,0,0,533,1795,0,18,133,19,29,332,425,8,29,1707,3102,466,0,70,0,213,0,0,0,418,0,0,
-0,636,11,152,1,1796,1,0,1568,1458,0,7,104,43,24,1903,311,4,0,0,692,410,0,223,0,56,0,0,0,1,0,0,
-0,0,0,0,0,0,0,0,0,1727,121,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-924,1,0,0,0,0,0,23,0,0,0,0,101,21,9,0,0,0,0,0,0,0,0,0,0,0,20,2,0,0,0,0,
-0,1699,1,48,2,2191,0,5,2051,2494,15,0,65,88,2,1665,2,0,1795,146,171,885,0,47,0,92,79,0,0,97,0,0,
-0,526,0,0,0,296,0,0,13938,1134,0,0,0,0,0,3993,0,0,642,0,0,206,0,235,0,121,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,116,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-27,0,0,0,0,0,0,2,0,0,0,0,6,2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,24,99,1883,425,787,342,210,0,372,0,647,871,523,596,53,63,0,823,5743,620,0,15,0,11,0,0,0,0,8,0,0,
-0,0,0,0,0,0,0,1,0,0,0,0,22,1,510,0,368,0,21,31,6,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,492,394,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-8,0,0,0,0,0,0,2,0,1,0,0,16,0,42,0,0,0,0,0,0,0,0,0,0,0,5,0,0,0,0,0,
-0,352,0,0,0,481,0,0,0,1703,0,0,0,0,0,266,0,0,0,0,0,6,0,0,0,21,0,0,0,0,0,0,
-0,158,0,0,0,244,0,0,1,143,0,0,0,0,0,89,0,0,0,0,0,6,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,284,16,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-7,0,0,0,0,0,0,3,0,0,0,0,26,4,4,0,0,0,0,0,0,0,0,0,0,0,1,0,0,0,0,0,
-0,691,39,1,6,304,1,1,32,534,0,1,9,1,10,190,0,0,12,2,3,0,0,0,0,0,0,0,0,11,0,0,
-0,663,0,0,0,1907,0,0,7625,2195,0,0,0,0,0,469,0,0,61,0,0,0,0,0,0,3,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,121,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-5,0,0,0,0,0,0,1,0,0,0,0,16,1,28,0,0,0,0,0,0,0,0,0,0,0,3,0,0,0,0,0,
-0,42,0,11,0,145,30,0,2,89,0,0,20,0,0,1,10,0,0,1,30,2,41,0,92,0,0,0,0,8,0,0,
-0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,1624,14,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-1452,0,0,0,0,0,0,11,0,0,0,0,114,19,5,0,0,0,0,0,0,0,0,0,0,0,44,2,0,0,0,0,
-0,7,23,84,0,99,0,1,0,1,0,0,91,173,27,416,1,0,269,213,28,0,2,2,0,0,27,0,0,132,0,0,
-0,2,0,0,0,751,0,0,0,21,0,0,0,0,0,2547,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,49,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-11,0,0,0,0,0,0,0,0,0,0,0,8,0,0,0,0,0,0,0,0,0,0,0,0,0,1,0,0,0,0,0,
-0,216,0,0,0,66,0,0,0,1,0,0,0,0,0,58,0,0,0,0,0,0,0,9,0,0,0,0,0,1,0,0,
-0,0,0,0,0,2,0,0,0,0,0,0,0,0,0,18,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-12,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,543,37,39,97,3770,103,48,90,5,4,88,38,56,8,13,47,3,441,208,485,10,1,114,0,0,0,0,0,0,0,0,
-0,0,1,0,1,0,0,0,0,0,0,0,0,0,0,0,2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,2,0,0,0,0,0,0,0,0,0,0,2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,17,5692,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-549,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,3,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,2,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,567,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-14020,238,0,0,1,0,0,355,0,0,0,0,778,187,281,0,0,0,0,0,0,0,0,0,0,0,85,102,0,0,0,94,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,5,0,0,
-0,1,2858,7663,9925,546,1740,4423,199,11395,305,7084,19898,8399,50548,81,3398,35,30931,18569,37081,3470,11106,2716,194,11040,360,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,46,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-298,12,0,0,0,0,0,86,0,0,0,0,104,20,40,0,0,0,0,0,0,0,0,0,0,0,17,18,0,0,0,17,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,5,0,0,
-0,3516,375,0,50,17543,0,3,60,1729,274,2,5828,30,7,4993,0,0,4649,630,442,5902,3,8,0,3455,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,22,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-361,13,0,0,0,0,0,5,0,0,0,0,81,3,93,0,0,0,0,0,0,0,0,0,0,0,14,16,0,0,0,12,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,42,0,0,
-0,7663,50,806,23,15220,0,0,14548,2527,0,4678,2100,6,0,14691,0,132,2801,46,3558,2351,0,0,0,627,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,435,3818,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-65355,837,0,0,0,0,0,746,0,0,0,0,8732,425,3575,0,0,0,0,0,0,0,0,0,0,0,1415,1800,0,0,0,950,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,205,0,0,
-0,4697,10,25,830,15865,181,781,21,8802,20,44,1122,308,421,9780,15,0,2587,6182,16,1620,444,337,0,2254,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,297,7270,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-125281,1796,0,1,0,0,0,3203,0,0,0,0,17027,1240,7914,0,0,0,0,0,0,0,0,0,0,0,2998,3488,0,0,0,2259,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,458,0,0,
-0,28719,581,5906,17398,17460,4012,1708,727,5748,61,701,16031,7917,34343,1090,3889,470,57539,31505,14508,1562,5320,2679,1843,5263,85,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,11,815,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-22847,88,0,0,0,0,0,85,0,0,0,0,864,205,472,0,0,0,0,0,0,0,0,0,0,0,186,222,0,0,0,125,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,38,0,0,
-0,6875,0,0,0,6909,3096,0,0,4883,0,0,1808,0,5,14686,7,0,4870,150,2021,2459,0,1,0,186,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,4,746,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-11675,179,0,0,0,0,0,360,0,0,0,0,1743,277,944,0,0,0,0,0,0,0,0,0,0,0,374,448,0,0,0,254,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,183,0,0,
-0,3692,86,0,134,8940,12,557,9600,3028,0,0,1795,271,1101,6506,5,0,4940,1651,221,2120,0,3,0,115,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,78,1191,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-23689,292,0,0,0,0,0,848,0,0,0,0,2880,230,1177,0,0,0,0,0,0,0,0,0,0,0,409,485,0,0,0,233,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,54,0,0,
-0,42464,142,23,48,83815,154,0,18,32699,0,0,216,321,514,23318,3,8,2214,630,6668,2800,3,73,0,6663,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,4,10,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-57,4,0,0,0,0,0,349,0,0,0,0,39,16,17,0,0,0,0,0,0,0,0,0,0,0,4,4,0,0,0,1,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,2,0,0,
-0,2731,846,8764,7026,10398,5040,7133,25,17,0,2622,14900,9844,50832,7278,1633,95,12573,35259,29369,883,5609,11,408,0,609,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,4,0,0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,220,0,0,0,1010,0,0,0,13,0,0,0,0,0,749,0,0,0,0,0,958,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,3,489,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-6447,206,0,0,0,0,0,678,0,0,0,0,1693,156,583,0,0,0,0,0,0,0,0,0,0,0,240,254,0,0,0,163,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,20,0,0,
-0,45,11,3,1,10515,61,1,6,4301,0,0,405,18,3627,131,1,0,26,1780,3,21,0,33,0,113,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,140,1143,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-24513,381,0,0,0,0,0,1046,0,0,0,0,3059,408,1473,0,0,0,0,0,0,0,0,0,0,0,556,683,0,0,0,274,
-0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,39,0,0,
-0,10779,216,573,11146,21300,2708,79,4,12785,0,808,30270,519,74,16181,553,1,165,2998,2542,1665,853,83,0,6426,4,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,7,636,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-11557,234,0,0,0,0,0,470,0,1,0,0,2118,60,1312,0,0,0,0,0,0,0,0,0,0,0,499,521,0,0,0,318,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,94,0,0,
-0,15479,2277,1,0,27392,313,1,1,6398,0,0,140,1376,423,8832,3385,0,12,1843,18,3541,7,26,0,12237,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,1125,2545,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-41679,767,0,0,0,0,0,2261,0,1,0,0,6067,353,2947,0,0,0,0,0,0,0,0,0,0,0,1204,1285,0,0,0,831,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,367,0,0,
-0,4086,138,8886,45037,18299,1306,23387,247,5252,323,3102,947,249,2032,23325,113,288,407,7983,20702,829,572,238,5,2502,57,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,891,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-36271,388,0,0,0,0,0,1300,0,0,0,0,2896,624,1035,0,0,0,0,0,0,0,0,0,0,0,404,530,0,0,0,443,
-0,0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,11,0,0,
-0,1625,1825,1858,7299,1361,19076,903,355,2067,79,2698,8278,15775,30844,12322,2699,23,37848,7449,18500,56617,5855,17689,160,1672,139,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,274,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-3046,79,0,0,0,0,0,330,0,0,0,0,606,93,340,6,0,0,0,0,0,0,0,0,0,0,134,135,0,0,0,81,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,10,0,0,
-0,6054,26,4,5,9136,14,0,1131,3190,0,24,4318,11,3,6634,2200,0,7781,999,1552,2055,0,29,0,355,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,3011,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,884,2306,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-49216,660,0,0,0,0,0,2526,0,2,0,0,6843,559,2966,2,0,0,0,0,0,0,0,0,0,0,1320,1373,0,0,0,905,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,263,0,0,
-0,12847,599,2377,10826,44849,836,1643,201,14285,68,1655,2104,2671,3772,16034,901,67,3955,11971,11027,4651,2001,458,0,5464,3,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,141,4461,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-70864,1264,0,0,0,0,0,1197,0,2,0,0,11736,257,4595,0,0,0,0,0,0,0,0,0,0,0,1998,2276,0,0,0,1272,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,907,0,0,
-0,6741,587,2425,300,25432,199,186,14975,10135,9,725,1784,856,203,12106,5232,109,9,9193,30854,5919,2,2978,0,471,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,477,3868,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-75329,791,0,0,0,0,0,1547,4,1,0,0,8653,567,4110,0,0,0,0,0,0,0,0,0,0,0,1685,1765,0,0,0,1108,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1434,0,0,
-0,9363,27,1448,3,23420,174,10,103097,13567,6,0,3835,141,386,26524,12,0,8815,5193,4464,4208,1,1844,0,4177,11,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,517,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-15641,141,0,0,0,0,0,326,0,0,0,0,2037,23,766,0,0,0,0,0,0,0,0,0,0,0,265,252,0,0,0,359,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,1268,1401,4714,1806,4523,627,4338,0,2072,2,659,9869,2517,10973,386,3715,0,23727,14956,13583,4,16,0,44,124,33,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,1,0,0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,2047,0,0,0,27918,0,0,0,4777,0,0,2,0,0,1534,0,0,6,2,0,54,0,0,0,357,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,58,591,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-8212,249,0,0,0,0,0,550,0,0,0,0,1894,168,528,0,0,0,0,0,0,0,0,0,0,0,221,232,0,0,0,203,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,26,0,0,
-0,8480,44,5,233,13109,99,4,10099,17850,0,42,375,11,3596,9040,1,0,1289,1663,37,3,0,0,0,31,1,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,24,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-227,10,0,0,0,0,0,78,0,0,0,0,66,9,35,0,0,0,0,0,0,0,0,0,0,0,14,17,0,0,0,9,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,0,0,
-0,180,0,585,0,1377,30,0,30,1102,0,0,4,1,0,11,395,12,0,3,633,21,0,0,0,5,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,79,2228,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-44195,660,0,0,0,0,0,933,1,0,0,0,7236,317,2575,0,0,0,0,0,0,0,0,0,0,0,923,1026,0,0,0,619,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,110,0,0,
-0,460,69,28,23,3916,46,15,14,633,0,3,85,302,45,20708,135,0,367,2297,76,0,12,29,4,0,8,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-23,3,0,0,0,0,0,0,0,0,0,0,24,8,6,0,0,0,0,0,0,0,0,0,0,0,8,6,0,0,0,3,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,157,0,0,0,923,0,0,0,60,0,0,28,0,0,62,0,0,0,0,0,11,4,4,0,34,53,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,6,470,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-150,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,
-0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0
-};
+++ /dev/null
-int x = -65535;
-int y = 32768;
-
-int main()
-{
- return x + y + 32767;
-}
+++ /dev/null
-int a = 0;
-int b = 3;
-
-int main() {
- int res = (a-b) * (a-b);
- printf("%d\n", res);
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-int main(int argc, char **argv) {
- printf("Result: %d (should be 42)\n", rot(21,1));
-
- return 0;
-}
-
-unsigned rot(unsigned x, unsigned y)
-{
- return x << y | x >> (32-y);
-}
+++ /dev/null
-static unsigned int rotater3(unsigned int a)
-{
- return (a << 3) | (a >> 29);
-}
-
-static unsigned int rotatel3(unsigned int a)
-{
- return (a >> 3) | (a << 29);
-}
-
-static unsigned int rotater(unsigned int a, unsigned int b)
-{
- return (a >> b) | (a << (32-b));
-}
-
-
-int main()
-{
- printf("5 >>r>> 3 = %d\n", rotater3(5));
- printf("5 <<r<< 3 = %d\n", rotatel3(5));
- printf("5 >>r>> 4 = %d\n", rotater(5,4));
-
- return 0;
-}
+++ /dev/null
-#include <math.h>
-#include <string.h>
-#include <stdlib.h>
-#include <stdio.h>
-
-/* transform into Abs node, gcc(+), icc(+), cl(+) */
-int test_abs(int a) {
- return abs(a);
-}
-
-/* transform into Abs node, gcc(+), icc(+), cl(?) */
-long test_labs(long a) {
- return labs(a);
-}
-
-/* transform into Abs node, gcc(+), icc(+), cl(+) */
-double test_fabs(double a) {
- return fabs(a);
-}
-
-/* transform info memcpy(test + strlen(test), "ab", 2), gcc(+), icc(-), cl(-) */
-char *test_strcat(void) {
- static char test[10] = "ab";
- return strcat(test, "bc");
-}
-
-/* evaluate, gcc(+), icc(-), cl(-) */
-char *test_strchr(void) {
- return strchr("abc", 'b');
-}
-
-/* evaluate, gcc(+), icc(-), cl(-) */
-char *test_strrchr(void) {
- return strrchr("abc", 'b');
-}
-
-/* evaluate into 0, gcc(+), icc(-), cl(-) */
-int test_strcmp1(const char *s) {
- return strcmp(s, s);
-}
-
-/* transform info -(*s), gcc(+), icc(-), cl(-) */
-int test_strcmp2(const char *s) {
- return strcmp("", s);
-}
-
-/* transform info *s, gcc(+), icc(-), cl(-) */
-int test_strcmp3(const char *s) {
- return strcmp(s, "");
-}
-
-/* evaluate, gcc(+), icc(-), cl(-) */
-int test_strcmp4(void) {
- return strcmp("ab", "cd");
-}
-
-/* evaluate into 0, gcc(+), icc(-), cl(-) */
-int test_strncmp1(const char *s, int len) {
- return strncmp(s, s, len);
-}
-
-/* transform info -(*s), gcc(+), icc(-), cl(-) */
-int test_strncmp2(const char *s) {
- return strncmp("", s, 1);
-}
-
-/* transform info *s, gcc(+), icc(-), cl(-) */
-int test_strncmp3(const char *s) {
- return strncmp(s, "", 1);
-}
-
-/* evaluate, gcc(+), cl(-) */
-int test_strncmp4(void) {
- return strncmp("ab", "cd", 2);
-}
-
-/* evaluate, gcc(+), cl(-) */
-int test_strncmp5(char *a, char *b) {
- return strncmp(a, b, 0);
-}
-
-/* transform into *s = '\0', s, gcc(+), icc(-), cl(+) */
-char *test_strcpy1(char *s) {
- return strcpy(s, "");
-}
-
-/* transform into memcpy(s, c, len(c)+1), gcc(+), icc(-), cl(+) */
-char *test_strcpy2(char *s) {
- return strcpy(s, "ab");
-}
-
-/* evaluate, gcc(+), icc(+), cl(+) */
-int test_strlen(void) {
- return strlen("ab");
-}
-
-/* transform into d, gcc(+), icc(+), cl(-) */
-void *test_memcpy1(void *d, void *s) {
- return memcpy(d, s, 0);
-}
-
-/* transform into *(char *)d = *(char *)s, d, gcc(+), icc(+), cl(+) */
-void *test_memcpy2(void *d, void *s) {
- return memcpy(d, s, 1);
-}
-
-/* transform into *(short *)d = *(short *)s, d, gcc(+), icc(+), cl(+) */
-void *test_memcpy3(short *d, short *s) {
- return memcpy(d, s, 2);
-}
-
-/* transform into *(int *)d = *(int *)s, d, gcc(+), icc(+), cl(+) */
-void *test_memcpy4(int *d, int *s) {
- return memcpy(d, s, 4);
-}
-
-/* transform into *(long long *)d = *(long long *)s, d, gcc(+), icc(+), cl(+) */
-void *test_memcpy5(long long *d, long long *s) {
- return memcpy(d, s, 8);
-}
-
-/* transform into d, gcc(+), icc(+), cl(-) */
-void *test_memset1(void *d, int C) {
- return memset(d, C, 0);
-}
-
-/* transform into *(char *)d = (char)C, d, gcc(+), icc(+), cl(+) */
-void *test_memset2(void *d, int C) {
- return memset(d, C, 1);
-}
-
-/* transform into *(short *)d = (short)((char)C * 0x0101), d, gcc(+), icc(+), cl(+) */
-void *test_memset3(short *d, int C) {
- return memset(d, C, 2);
-}
-
-/* transform into *(int *)d = (int)((char)C * 0x01010101), d, gcc(+), icc(+), cl(+) */
-void *test_memset4(int *d, int C) {
- return memset(d, C, 4);
-}
-
-/* transform into *(long long *)d = (long long)((char)C) * 0x0101010101010101, d, gcc(+), icc(+), cl(+) */
-void *test_memset5(long long *d, int C) {
- return memset(d, C, 8);
-}
-
-/* evaluate into 1.0, gcc(+), icc(-), cl(-) */
-double test_pow1(double a) {
- return pow(1.0, a);
-}
-
-/* evaluate into 1.0, gcc(+), icc(+), cl(-) */
-double test_pow2(double a) {
- return pow(a, 0.0);
-}
-
-/* transform into sqrt(a), gcc(-), icc(+), cl(-) */
-double test_pow3(double a) {
- return pow(a, 0.5);
-}
-
-/* evaluate into a, gcc(+), icc(+), cl(-) */
-double test_pow4(double a) {
- return pow(a, 1.0);
-}
-
-/* evaluate into 1.0/a. gcc(+), icc(+), cl(-) */
-double test_pow5(double a) {
- return pow(a, -1.0);
-}
-
-/* evaluate into 1.0 gcc(+), icc(+), cl(-) */
-double test_exp1(void) {
- return exp(0.0);
-}
-
-/* evaluate into M_E gcc(+), icc(-), cl(?) */
-double test_exp2(void) {
- return exp(1.0);
-}
-
-/* evaluate gcc(-), icc(-), cl(?) */
-double test_exp3(void) {
- return exp(7.3434);
-}
-
-/* evaluate into 0.0 gcc(+), icc(-), cl(?) */
-double test_log1(void) {
- return log(1.0);
-}
-
-/* evaluate into 0.0 gcc(+), icc(-), cl(?) */
-double test_log2(void) {
- return log2(1.0);
-}
-
-/* evaluate into 0.0 gcc(+), icc(-), cl(?) */
-double test_log3(void) {
- return log10(1.0);
-}
-
-/* evaluate into 0.0 gcc(+), icc(-), cl(?) */
-double test_trunc1(void) {
- return trunc(0.1);
-}
-
-/* evaluate into 0.0 gcc(+), icc(-), cl(?) */
-double test_trunc2(void) {
- return trunc(-8.9);
-}
-
-/* transform into putchar, gcc(+), icc(-), cl(-) */
-void test_printf1() {
- printf("\n");
-}
-
-/* transform into putchar(c), gcc(+), icc(+), cl(-) */
-void test_printf2(char c) {
- printf("%c", c);
-}
-
-/* transform into puts(s), gcc(+), icc(-), cl(-) */
-void test_printf3(char *s) {
- printf("%s\n", s);
-}
-
-/* transform into fwrite(s,strlen(s),f), gcc(+) OR fputs(s, f), icc(+), cl(-) */
-void test_fprintf1(FILE *f) {
- fprintf(f, "ab");
-}
-
-/* transform into fputc(c,f), gcc(+), icc(+), cl(-) */
-void test_fprintf2(FILE *f, char c) {
- fprintf(f, "%c", c);
-}
-
-/* transform into fputs(s,file), gcc(+), icc(+), cl(-) */
-void test_fprintf3(FILE *f, char *s) {
- fprintf(f, "%s", s);
-}
-
-/* transform into memcpy(d,s,strlen(s)+1,1), gcc(+), icc(-), cl(-) */
-void test_sprintf1(char *d) {
- sprintf(d, "ab");
-}
-
-/* transform into d[0] = c; d[1] = '\0';, gcc(-), icc(-), cl(-) */
-void test_sprintf2(char *d, char c) {
- sprintf(d, "%c", c);
-}
-
-/* transform into memcpy(d, s, strlen(s)+1, 1)), gcc(-), icc(-), cl(-) */
-void test_sprintf3(char *d, char *s) {
- sprintf(d, "%s", s);
-}
-
-/* transform fwrite(s,1,strlen(s),F), gcc(+), icc(-), cl(-) */
-void test_fputs(FILE *f) {
- fputs("abs", f);
-}
-
-/* evaluate to 0, gcc(-), icc(-), cl(-) */
-int test_fwrite1(FILE *f, char *s, int l) {
- return fwrite(s, 0, l, f);
-}
-
-/* evaluate to 0, gcc(-), icc(-), cl(-) */
-int test_fwrite2(FILE *f, char *s, int l) {
- return fwrite(s, l, 0, f);
-}
-
-/* transform into fputc(s[0],F) if this is usefull ..., gcc(-), icc(-), cl(-) */
-int test_fwrite3(FILE *f, char *s, int l) {
- return fwrite(s,1,1,f);
-}
-
-/* evaluate, gcc(+), cl(-) */
-double test_sin1(void) {
- return sin(0.0);
-}
-
-/* transform into fsin, gcc(+), cl(-) */
-double test_sin2(double x) {
- return sin(x);
-}
-
-/* transform into cos(x), gcc(+), icc(-), cl(-) */
-double test_cos1(double x) {
- return cos(-x);
-}
-
-/* evaluate, gcc(+), cl(-) */
-double test_cos2(void) {
- return cos(0.0);
-}
-
-/* transform into fcos, gcc(+), cl(-) */
-double test_cos3(double x) {
- return cos(x);
-}
-
-/* transform into cosf(x), gcc(+), icc(-), cl(-) */
-float test_cosf1(float x) {
- return cosf(-x);
-}
-
-#if 0
-/* transform into cosl(x), gcc(+), icc(-), cl(-) */
-long double test_cosl(long double x) {
- return cosl(-x);
-}
-#endif
-
-/* evaluate, gcc(+), cl(-) */
-double test_tan1(void) {
- return tan(0);
-}
-
-/* evaluate, gcc(-), cl(-) */
-double test_asin1(void) {
- return asin(0.0);
-}
-
-/* evaluate, gcc(-), cl(-) */
-double test_acos1(void) {
- return acos(1.0);
-}
-
-/* evaluate, gcc(+), cl(-) */
-double test_atans1(void) {
- return atan(0.0);
-}
-
-/* evaluate into 0.0, gcc(+), icc(+), cl(-) */
-double test_sqrt1(void) {
- return sqrt(0.0);
-}
-
-/* evaluate into 1.0, gcc(+), icc(+), cl(-) */
-double test_sqrt2(void) {
- return sqrt(1.0);
-}
-
-/* evaluate, gcc(+), icc(+), cl(-) */
-double test_sqrt3(void) {
- return sqrt(7.345);
-}
-
-/* evaluate into 0.0, gcc(+), icc(-), cl(?) */
-double test_cbrt1(void) {
- return cbrt(0.0);
-}
-
-/* evaluate into 1.0, gcc(+), icc(-), cl(?) */
-double test_cbrt2(void) {
- return cbrt(1.0);
-}
-
-/* evaluate into -1.0, gcc(+), icc(-), cl(?) */
-double test_cbrt3(void) {
- return cbrt(-1.0);
-}
-
-/* transform exit(3) into a return 3, gcc(-), icc(-), cl(-) */
-int main() {
- printf("%f\n", test_asin1());
- printf("%f\n", test_acos1());
- exit(0);
- return 42;
-}
+++ /dev/null
-/*$Header$*/
-#include <stdio.h>
-#include <stdlib.h>
-#include <math.h>
-#include <fcntl.h>
-
-#ifdef PLATFORM_NT
-#include <io.h>
-#endif
-#ifdef PLATFORM_LINUX
-#endif
-
-#define TRUE 1
-#define FALSE 0
-
-#define MODE_RECOGNIZE 0
-#define MODE_TRAIN1 1
-#define MODE_TRAIN2 2
-
-void alloc_td_bu();
-
-
-unsigned char **cimage;
-double **tds;
-double **bus;
-int lwidth,lheight;
-int width, height,numinputs;
-long i,j;
-
-int pass_flag;
-int highx[2], highy[2];
-double highest_confidence[2];
-int set_high[2];
-
-#define DB1 1
-#define DB2 0
-#define DB3 1
-
-FILE *fp;
-
-int winner,numf1s,numf2s, resonant,cp,numpatterns;
-
-double a, b, c, d, theta, delta_t;
-double rho;
-
-typedef struct {
- double *I;
- double W;
- double X;
- double V;
- double U;
- double P;
- double Q;
- double R;
- } f1_neuron;
-
-f1_neuron *f1_layer;
-
-typedef struct {
- double y;
- int reset;
- } xyz;
-
-xyz *Y;
-
-
-double g(i)
-int i;
-{ double result;
- if (i != winner)
- result =0;
- else
- if ( Y[i].y > 0)
- result = d;
- else
- result =0;
- return(result);
-}
-
-void find_match()
-{ int i;
- winner = 0;
- for (i=0;i<numf2s;i++)
- if (Y[i].y > Y[winner].y)
- winner =i;
-}
-
-double simtest()
-{ int j;
- double sum,norm;
- double temp_sum;
-
- sum = norm =0;
- for (j=0;j<numf1s;j++)
- {
- norm += f1_layer[j].P * f1_layer[j].P;
- }
- norm = sqrt((double) norm);
- norm *= c;
- sum += norm;
- norm =0;
- for (j=0;j<numf1s;j++)
- {
- temp_sum = f1_layer[j].U * f1_layer[j].U;
- norm += temp_sum;
- }
- norm = sqrt((double) norm);
- sum += norm;
- for (j=0;j<numf1s;j++)
- f1_layer[j].R = (f1_layer[j].U+ c * f1_layer[j].P)/sum;
- norm = 0;
- for (j=0;j<numf1s;j++)
- norm += f1_layer[j].R * f1_layer[j].R;
- norm = sqrt((double) norm);
-#ifdef DEBUG
- if (DB2 && (winner==0)) printf("%5.3f",norm);
-#endif
-return(norm);
-}
-
-
-double simtest2()
-{ int j;
- double Su,Sp,numerator,denom;
- double su,sp;
- double su2,sp2;
- double sup;
- double r;
- double e = 0.0000000001; /* 10e-10 */
-
- su = sp = sup = su2 = sp2=numerator= 0.0;
- for (j=0;j<numf1s;j++)
- {
- su += f1_layer[j].U;
- sp += f1_layer[j].P;
- su2 += f1_layer[j].U * f1_layer[j].U;
- sp2 += f1_layer[j].P * f1_layer[j].P;
- sup += f1_layer[j].U * f1_layer[j].P;
- }
- Su = ((double)numf1s*su2-su*su)/((double)numf1s*((double)numf1s-1.0));
- Su = sqrt(Su);
- Sp = ((double)numf1s*sp2-sp*sp)/((double)numf1s*((double)numf1s-1.0));
- Sp = sqrt(Sp);
- numerator = (double) numf1s * sup - su * sp;
- denom = sqrt((double) numf1s*su2 - su*su) * sqrt((double) numf1s*sp2 - sp*sp);
- r = (numerator+e)/(denom+e);
-
- if ((numerator == 0) || (denom==0))
- {
- fprintf(stderr,"potential div by zero");
- r=1;
- }
- if ((numerator != 0) && (denom==0))
- {
- fprintf(stderr,"div by zero");
- r=1;
- }
- r *= r; /* trying to match inverse images */
-#ifdef DEBUG
- if (DB1) printf( " simtest2(r) = %8.6f\n",r);
- if (DB2 && (winner==0)) printf("%8.4f",r);
-#endif
- return (r);
-}
-
-void weightadj()
-{ int i,j,k;
- double temp;
- double er = 0.000000001;
-#ifdef DEBUG
- int bad_count;
- int good_count;
-#endif
-
- i = winner;
-#ifdef DEBUG
- fprintf(stdout,"winner %d\n",i);
-#endif
- for (k=0;k<1;k++)
- { resonant=0;
- for (j=0;j<numf1s;j++)
- { temp = tds[j][i];
- tds[j][i] += g(i)*(f1_layer[j].P - tds[j][i])*delta_t;
- if (fabs(temp - tds[j][i]) <= er)
- resonant = 1;
- }
-#ifdef DEBUG
- bad_count=0;
- good_count = 0;
-#endif
- for (j=0;j<numf1s;j++)
- { temp = bus[j][i];
- bus[j][i] += g(i) * (f1_layer[j].P - bus[j][i]) * delta_t;
- if ((fabs(temp - bus[j][i]) <= er) && resonant)
- {
-#ifdef DEBUG
- good_count++;
-#endif
- resonant =1;
- }
- else
- {
-#ifdef DEBUG
- bad_count++;
-#endif
- resonant =0;
- }
- }
- }
-#ifdef DEBUG
- printf("bad %d good %d\n",bad_count,good_count);
-#endif
-}
-
-/* init_globs - initialize ART 2 parameters based
- * on whether we are training a network or loading
- * the weights of a pretrained network.
- */
-void init_globs(int mode)
-{
- if (mode==MODE_RECOGNIZE)
- {
- a = 255;
- b = 0.0;
- c = 0.11;
- d = 0.9;
- theta = 1/sqrt((double) numf1s);
- delta_t = 0.1;
- rho = 0.70;
- }
- else
- {
- a = 255;
- b = 10.0;
- c = 0.11;
- d = 0.9;
- theta = 1/sqrt((double) numf1s);
- delta_t = 0.7;
- rho = 0.95;
- }
-} /* end of init_globs */
-
-void init_net()
-{
- int i;
-
- f1_layer = (f1_neuron *)malloc(numf1s * sizeof (f1_neuron));
- if (f1_layer==NULL)
- {
- fprintf(stderr,"malloc error in init_net\n");
- exit(1);
- }
- for (i=0;i<numf1s;i++)
- {
-
- f1_layer[i].I = (double *)malloc(2*sizeof(double));
- if (f1_layer[i].I==NULL)
- {
- fprintf(stderr,"malloc error in init_net\n");
- exit(1);
- }
- f1_layer[i].W = 0;
- f1_layer[i].X = 0;
- f1_layer[i].V = 0;
- f1_layer[i].U = 0;
- f1_layer[i].P = 0;
- f1_layer[i].Q = 0;
- f1_layer[i].R = 0;
- }
-
- Y = (xyz *)malloc(numf2s*sizeof(xyz));
- if (Y==NULL)
- {
- fprintf(stdout,"Malloc error for Y\n");
- exit(1);
- }
-
-}
-
-void analog_conv()
-{ int j,lines,k;
- int x1,x2;
- double y1,y2;
-
- fscanf(fp,"%i",&lines);
- for (j=0;j<lines;j++)
- { fscanf(fp,"%i %f %i %f",&x1,&y1,&x2,&y2);
- for (k=x1;k<=x2;k++)
- f1_layer[k].I[cp] = ((y2-y1)/(x2-x1) * (k-x2)) + y2;
- /*I[cp][k] = ((y2-y1)/(x2-x1) * (k-x2)) + y2;*/
- }
-
-}
-
-void get_pat()
-{ int i;
-
- for(i=0;i<numf1s;i++)
- fscanf(fp,"%f",&f1_layer[i].I[cp]);
-}
-
-void show_pat()
-{ int i;
-
- for(i=0;i<numf1s;i++)
- { if ( (i%5) == 0)
- printf("\n");
- printf(" %8.5f ",f1_layer[i].I[cp]);
- }
- printf("\n\n");
-/* getchar();*/
-}
-
-void reset_nodes()
-{ int i;
-
- for (i=0;i<numf1s;i++)
- {
- f1_layer[i].W = 0.0;
- f1_layer[i].X = 0.0;
- f1_layer[i].V = 0.0;
- f1_layer[i].U = 0.0;
- f1_layer[i].P = 0.0;
- f1_layer[i].Q = 0.0;
- f1_layer[i].R = 0.0;
- }
- for (i=0;i<numf2s;i++)
- { Y[i].y = 0.0;
- Y[i].reset =0;
- }
- winner = 0;
- resonant = 0;
-}
-
-
-void reset_nodes2()
-{ int i;
-
- for (i=0;i<numf1s;i++)
- {
- f1_layer[i].W = 0.0;
- f1_layer[i].X = 0.0;
- f1_layer[i].V = 0.0;
- f1_layer[i].U = 0.0;
- f1_layer[i].P = 0.0;
- f1_layer[i].Q = 0.0;
- f1_layer[i].R = 0.0;
- }
- for (i=0;i<numf2s;i++)
- Y[i].y = 0.0;
- winner = 0;
- resonant = 0;
-}
-
-
-
-void print_weights()
-{ int i,j;
-
- /* print td's */
- printf("============ TOP down WEIGHTS ==============\n");
- for (i=0;i<numf1s;i++)
- for (j=0;j<numf2s;j++)
- if (j==(numf2s-1))
- printf(" %8.16f\n",tds[i][j]);
- else
- printf(" %8.16f ",tds[i][j]);
- /* print bu's */
- printf("============ BOTTOM up WEIGHTS ==============\n");
- for (i=0;i<numf1s;i++)
- for (j=0;j<numf2s;j++)
- if (j==(numf2s-1))
- printf(" %8.16f\n",bus[i][j]);
- else
- printf(" %8.16f ",bus[i][j]);
-}
-
-
-void print_f12()
-{ int j;
- printf("\n\n");
- for(j=0;j<numf2s;j++)
- printf(" j = %i Y= %9.7f\n",j,Y[j].y);
-}
-
-void train_match(int spot)
-{ int j,matched,f1res,mt;
- int ti,tj,tresult;
- double tnorm;
- double xr,qr,tsum,ttemp;
- char matchtest;
- double match_confidence;
- f1res=0;
- reset_nodes();
- cp =spot;
- matched = 0;
- while (!matched)
- {
- f1res = 0;
- for (j=0;j<9 && !f1res ;j++)
- {
-
- /* Compute F1 layer - W values */
- tnorm = 0;
- for (ti=0;ti<numf1s;ti++)
- {
- f1_layer[ti].W = f1_layer[ti].I[cp] + a*(f1_layer[ti].U);
- tnorm += f1_layer[ti].W * f1_layer[ti].W;
- }
- tnorm = sqrt((double)tnorm);
- /* Compute F1 layer - X values */
-
- for (tj=0;tj<numf1s;tj++)
- f1_layer[tj].X = f1_layer[tj].W/tnorm;
-
- /* Compute F1 layer - V values */
-
- tnorm =0;
- for (ti=0;ti<numf1s;ti++)
- {
- if (f1_layer[ti].X < theta)
- xr = 0;
- else
- xr = f1_layer[ti].X;
- if (f1_layer[ti].Q < theta)
- qr = 0;
- else
- qr = f1_layer[ti].Q;
- f1_layer[ti].V = xr + b*qr;
- tnorm += f1_layer[ti].V * f1_layer[ti].V;
- }
-
- /* Compute F1 layer - U values */
- tnorm = sqrt((double) tnorm);
- for (tj=0;tj<numf1s;tj++)
- f1_layer[tj].U = f1_layer[tj].V/tnorm;
-
-
-
- /* Compute F1 layer - P values */
- tnorm =0;
- tsum=0;
- tresult = 1;
- for (ti=0;ti<numf1s;ti++)
- {
- tsum = 0;
- ttemp = f1_layer[ti].P;
-
- for (tj=spot;tj<numf2s;tj++)
- {
- if ((tj == winner)&&(Y[tj].y > 0))
- tsum += tds[ti][tj] * d;
- }
-
- f1_layer[ti].P = f1_layer[ti].U + tsum;
-
- tnorm += f1_layer[ti].P * f1_layer[ti].P;
-
- if (ttemp != f1_layer[ti].P)
- tresult=0;
- }
- f1res = tresult;
-
- /* Compute F1 - Q values */
-
- tnorm = sqrt((double) tnorm);
- for (tj=0;tj<numf1s;tj++)
- f1_layer[tj].Q = f1_layer[tj].P;
-
- /* Compute F2 - y values */
- for (tj=spot;tj<numf2s;tj++)
- {
- Y[tj].y = 0;
- if ( !Y[tj].reset )
- for (ti=0;ti<numf1s;ti++)
- Y[tj].y += f1_layer[ti].P * bus[ti][tj];
- }
-
- /* Find match */
- winner = 0;
- for (ti=spot;ti<numf2s;ti++)
- {
- if (Y[ti].y > Y[winner].y)
- winner =ti;
- }
-
-
- }
-#ifdef DEBUG
- if (DB1) print_f12();
- if (DB1) printf("\n num iterations for p to stabalize = %i \n",j);
-#endif
- match_confidence=simtest();
-#ifdef DEBUG
-fprintf(stdout,"rho %e\n",match_confidence);
-#endif
- if ((match_confidence) > rho)
- {
-#ifdef DEBUG
- if (DB2 && (winner==0)) printf("#%i",winner);
-#endif
- weightadj();
- matched = 1;
- }
- else
- { Y[winner].y = 0;
- Y[winner].reset = 1;
-#ifdef DEBUG
- if (DB1) printf("#%iN",winner);
-#endif
- matchtest=0;
- for (mt=spot;mt<numf2s;mt++)
- if (Y[mt].reset==0)
- matchtest =1;
- if (matchtest)
- find_match();
- else
- matched = 1;
- }
- } /* end while */
-} /* end of train_match() */
-
-void match()
-{ int j,matched,f1res,mt;
- int ti,tj,tresult;
- double tnorm;
- double xr,qr,tsum,ttemp;
- char matchtest;
- double match_confidence;
- f1res=0;
-
- cp =0;
- reset_nodes();
-
- matched = 0;
- while (!matched)
- {
- reset_nodes2();
- f1res = 0;
- for (j=0;j<9 && !f1res ;j++)
- {
-
- /* Compute F1 layer - W values */
- tnorm = 0;
- for (ti=0;ti<numf1s;ti++)
- {
- f1_layer[ti].W = f1_layer[ti].I[cp] + a*(f1_layer[ti].U);
- tnorm += f1_layer[ti].W * f1_layer[ti].W;
- }
- tnorm = sqrt((double)tnorm);
- /* Compute F1 layer - X values */
-
- for (tj=0;tj<numf1s;tj++)
- f1_layer[tj].X = f1_layer[tj].W/tnorm;
-
- /* Compute F1 layer - V values */
-
- tnorm =0;
- for (ti=0;ti<numf1s;ti++)
- {
- if (f1_layer[ti].X < theta)
- xr = 0;
- else
- xr = f1_layer[ti].X;
- if (f1_layer[ti].Q < theta)
- qr = 0;
- else
- qr = f1_layer[ti].Q;
- f1_layer[ti].V = xr + b*qr;
- tnorm += f1_layer[ti].V * f1_layer[ti].V;
- }
-
- /* Compute F1 layer - U values */
- tnorm = sqrt((double) tnorm);
- for (tj=0;tj<numf1s;tj++)
- f1_layer[tj].U = f1_layer[tj].V/tnorm;
-
-
-
- /* Compute F1 layer - P values */
- tnorm =0;
- tsum=0;
- tresult = 1;
- for (ti=0;ti<numf1s;ti++)
- {
- tsum = 0;
- ttemp = f1_layer[ti].P;
-
- for (tj=0;tj<numf2s;tj++)
- {
- if ((tj == winner)&&(Y[tj].y > 0))
- tsum += tds[ti][tj] * d;
- }
-
- f1_layer[ti].P = f1_layer[ti].U + tsum;
-
- tnorm += f1_layer[ti].P * f1_layer[ti].P;
-
- if (ttemp != f1_layer[ti].P)
- tresult=0;
- }
- f1res = tresult;
-
- /* Compute F1 - Q values */
-
- tnorm = sqrt((double) tnorm);
- for (tj=0;tj<numf1s;tj++)
- f1_layer[tj].Q = f1_layer[tj].P;
-
- /* Compute F2 - y values */
- for (tj=0;tj<numf2s;tj++)
- {
- Y[tj].y = 0;
- if ( !Y[tj].reset )
- for (ti=0;ti<numf1s;ti++)
- Y[tj].y += f1_layer[ti].P * bus[ti][tj];
- }
-
- /* Find match */
- winner = 0;
- for (ti=0;ti<numf2s;ti++)
- {
- if (Y[ti].y > Y[winner].y)
- winner =ti;
- }
-
-
- }
-#ifdef DEBUG
- if (DB1) print_f12();
- if (DB1) printf("\n num iterations for p to stabilize = %i \n",j);
-#endif
- match_confidence=simtest2();
- if ((match_confidence) > rho)
- {
- /* If the winner is not the default F2 neuron (the highest one)
- * we have a match.
- */
- if (winner!=numf2s-1)
- {
- pass_flag=1;
- fprintf(stdout,"F2 neuron %d passes vigilance with a value of %0.4f\n",winner,match_confidence);
- print_f12();
- if (match_confidence > highest_confidence[winner])
- {
- highest_confidence[winner] = match_confidence;
- set_high[winner] = TRUE;
- }
- }
- matched = 1;
- }
- else
- { Y[winner].y = 0;
- Y[winner].reset = 1;
-#ifdef DEBUG
- if (DB1) printf("#%i No",winner);
-#endif
- matchtest=0;
- for (mt=0;mt<numf2s;mt++)
- if (Y[mt].reset==0)
- matchtest =1;
- if (matchtest)
- find_match();
- else
- matched = 1;
- }
- } /* end while */
-}
-
-
-/*
- * loadimage - load image to scan
- * This was rewritten because Windows NT seems to have
- * problems with sequential calls to getc, scanf, fread,
- * and fread. The bug is flaky. It appears that I'd
- * only get one big read and all of the rest of the reads
- * would contain bogus data, yet no error condition is
- * generated by the read. Solution: one big read of the
- * whole image and then a copy to where I really want it,
- * cimage.
- */
-void loadimage(char *input_file)
-{
- int i,j;
- int fd;
- char buffer[64];
- char *superbuffer;
- if ((fd=open(input_file,O_RDONLY))==-1)
- {
- fprintf(stderr,"Error opening %s\n",input_file);
- exit(1);
- }
-#ifdef DEBUG
- printf("made it to loadimage\n");
-#endif
-
- /* Strip Format descriptor */
- read(fd,buffer,8);
- /* Read width */
- read(fd,buffer,4);
- for (i=0;i<4;i++)
- if (buffer[i] != ' ')
- width = width * 10 + buffer[i] - '0';
-
- /* Read height */
- read(fd,buffer,4);
- for (i=0;i<4;i++)
- if (buffer[i] != ' ')
- height = height * 10 + buffer[i] - '0';
-
-#ifdef DEBUG
- fprintf(stderr,"width %d, height %d\n",width,height);
-#endif
-
- superbuffer = (char *)malloc(width * height * sizeof(char ));
- if (superbuffer == NULL)
- {
- fprintf(stderr,"Problems with malloc in loadimage()\n");
- exit(1);
- }
- cimage = (unsigned char **) malloc(sizeof(unsigned char *) * height);
- if (cimage == NULL)
- {
- fprintf(stderr,"Problems with malloc in loadimage()\n");
- exit(1);
- }
-
- for (i=0;i<height;i++)
- {
- cimage[i] = (unsigned char *) malloc(width* sizeof(unsigned char));
- if (cimage[i]==NULL)
- {
- fprintf(stderr,"Problems with malloc in loadimage()\n");
- exit(1);
- }
- }
-
- read(fd,superbuffer,width*height);
- for (i=0;i<height;i++)
- {
- for (j=0;j<width;j++)
- {
- cimage[i][j] = superbuffer[i*width + j];
- }
- }
-
-
-#ifdef DEBUG
- printf(" upper left 10X10 corner of image\n");
- for (i=0;i<10;i++)
- {
- for (j=0;j<10;j++)
- printf("%4d",cimage[i][j]);
- printf("\n");
- }
-#endif
-
-}
-
-/* load_weights - load neural net weights
- * This seems to function properly which is odd because
- * loadimage does not. The only difference really is that
- * loadimage is trying to load bytes of any value, whereas
- * load_weights is looking at a file that only contains
- * ascii characters and reading them as ints or doubles.
- */
-void load_weights(char *weightfile)
-{ double a;
- long i,j;
-
- FILE *inp;
-
- if ((inp=fopen(weightfile,"r"))==NULL)
- {
- fprintf(stderr,"Unable to open %s\n",weightfile);
- exit(1);
- }
-
- printf("made it to load_weights\n");
- fscanf (inp,"%d %d",&lwidth,&lheight);
- numf1s = numinputs = lwidth * lheight;
- numf2s = numpatterns+1;
-
- alloc_td_bu();
-
- j = 0;
- for (i=0;i<numf1s;i++)
- { fscanf(inp,"%le",&a);
- bus[i][j] = tds[i][j] =a;
- }
-} /* end of load_weights */
-
-/* alloc_td_bu - memory alloc of top down and bottom up
- * connections
- */
-void alloc_td_bu()
-{
- bus = (double **)malloc(numf1s*sizeof(double *));
- tds = (double **)malloc(numf1s*sizeof(double *));
- if ((bus==NULL)||(tds==NULL))
- {
- fprintf(stderr,"Malloc problem in load_weights\n");
- exit(1);
- }
- for (i=0;i<numf1s;i++)
- {
- bus[i] = (double *)malloc(numf2s*sizeof(double));
- tds[i] = (double *)malloc(numf2s*sizeof(double));
- }
-} /* end of alloc_td_bu */
-
-/* init_td - initialize top down weights
- * start signifies which F2 neuron to initialize for. Enables
- * training on more than one image.
- */
-void init_td(int start)
-{
- int i,j;
- for (i=0;i<numf1s;i++)
- for (j=start;j<numf2s;j++)
- tds[i][j] = 0.0;
-} /* end of init_td */
-
-/* init_bu - initialize bottom up weights
- */
-void init_bu(int start )
-{
- int i,j;
- for (i=0;i<numf1s;i++)
- for (j=start;j<numf2s;j++)
- bus[i][j] = 1/(1.0 - d)/sqrt((double)numf1s);
-} /* end of init_bu */
-
-/* load_train - load a training file into
- * location f1_layer[].I[spot]
- */
-void load_train(char *trainfile,int mode, int objects)
-{
- int i;
- int fd;
- char buffer[64];
- char *superbuffer;
- unsigned char t;
- int spot;
-
- if (mode==MODE_TRAIN1)
- {
- spot=0;
- }
- else
- {
- spot=1;
- }
-
- if ((fd=open(trainfile,O_RDONLY))==-1)
- {
- fprintf(stderr,"Error opening %s\n",trainfile);
- exit(1);
- }
-#ifdef DEBUG
- printf("made it to load_train. opening %s\n",trainfile);
-#endif
-
- lwidth = 0;
- lheight = 0;
-
- /* Strip Format descriptor */
- read(fd,buffer,8);
- /* Read width */
- read(fd,buffer,4);
- for (i=0;i<4;i++)
- if (buffer[i] != ' ')
- lwidth = lwidth * 10 + buffer[i] - '0';
- /* Read height */
- read(fd,buffer,4);
- for (i=0;i<4;i++)
- if (buffer[i] != ' ')
- lheight = lheight * 10 + buffer[i] - '0';
-
-#ifdef DEBUG
- fprintf(stderr,"width %d, height %d\n",lwidth,lheight);
-#endif
-
- /* The first time through we set up the network
- * based on what is read from the file.
- * The second time through (if we have more than
- * one training file, we make sure the parameters
- * match what was read the first time, e.g. the
- * f1 layer is the same size.
- */
- if (mode==MODE_TRAIN1)
- {
- numf1s = numinputs = lwidth * lheight;
- numf2s = objects+1;
- init_globs(MODE_TRAIN1);
- init_net();
- }
- else
- {
- if ((lwidth * lheight)!= numf1s)
- {
- fprintf(stderr,"Dimensions of first image do not match");
- fprintf(stderr," dimensions of second.\n");
- exit(1);
- }
- }
-
- superbuffer = (char *)malloc(lwidth * lheight * sizeof(char ));
- if (superbuffer == NULL)
- {
- fprintf(stderr,"Problems with malloc in loadimage()\n");
- exit(1);
- }
-
- read(fd,superbuffer,lwidth*lheight);
- for (i=0;i<lheight*lwidth;i++)
- {
- t = superbuffer[i];
- f1_layer[i].I[spot] = (double) t;
- }
-
- free (superbuffer);
-
-} /* end of load_train */
-
-/* This routine is used to simulate training of other objects.
- * Training on multiple objects would consume the entire execution
- * time of the benchmark. Instead we train on a few then we simulate
- * others by copying the interconnections for the objects we are trained
- * on and then adding noise to the connections. This simulates training on
- * other objects. Need to blur the objects enough to overcome ART's
- * noise filtering.
- */
-void sim_other_objects(int low, int high, int stop)
-{
- int i,j;
- int noise1;
- double noise2;
-#ifdef DEBUG
- printf("sim other low %d high %d stop %d\n",low,high,stop);
- printf("sim other numf2s %d numpat %d\n",numf2s,numpatterns);
-#endif
- if (high<=low) {
- return;
- }
- srand(10);
- for (i=low;i<high;i++) {
- for (j=0;j<numf1s;j++) {
- if (i%low) {
- tds[j][i] = tds[j][0];
- tds[j][i] = bus[j][0];
- } else {
- tds[j][i] = tds[j][1];
- tds[j][i] = bus[j][1];
- }
- }
- }
- for (i=low;i<high;i++) {
- for (j=0;j<numf1s;j++) {
- noise1 = rand()&0xffff;
- noise2 = (double)noise1/(double)0xffff;
- tds[j][i] += noise2;
- bus[j][i] += noise2;
- }
- }
-#if 0
- for (i=low;i<high;i++) {
- for (j=0;j<numf1s;j++) {
- fprintf(stderr,"%d %d %f\n",i,j,tds[j][i]);
- }
- }
-#endif
-} /* sim_other_objects */
-
-void setup_base_pattern(int spot)
-{ int i,j;
-
- for (i=0;i<numf1s;i++)
- {
- for (j=spot;j<numf2s;j++)
- {
- tds[i][j] = bus[i][j] = 1.0 /sqrt((double)numf1s) /(1-d);
- }
- }
-}
-
-void scan_recognize(int startx, int starty, int endx, int endy, int stride)
-{
- int i,j,m,n;
- long k;
-
-
- if ((starty>(height-lheight+1))||(startx>(width-lwidth+1)))
- {
- fprintf(stderr,"Startx %d or Starty %d is out of range\n", startx, starty);
- exit(1);
- }
- if ((endy>(height-lheight+1))||(endx>(width-lwidth+1)))
- {
- fprintf(stderr,"endx %d or endy %d is out of range\n", endx, endy);
- exit(1);
- }
-#ifdef DEBUG
- if (DB3)
- {
- fprintf(stdout,"made it to scan_recognize\n");
- fprintf(stdout,"w= %d h = %d lw = %d lh = %d\n",width,height,lwidth,lheight);
- }
-#endif
- for (j=starty;j<endy;j=j+stride )
- for (i=startx;i<endx;i=i+stride)
- {
- k=0;
- for (m=j;m<(lheight+j);m++)
- for (n=i;n<(lwidth+i);n++)
- f1_layer[k++].I[0] = cimage[m][n];
- pass_flag =0;
- match();
- if (pass_flag==1)
- {
-#ifdef DEBUG
- printf(" at X= %d Y = %d\n",i,j);
-#endif
- if (set_high[0]==TRUE)
- {
- highx[0] = i;
- highy[0] = j;
- set_high[0] = FALSE;
- }
- if (set_high[1]==TRUE)
- {
- highx[1] = i;
- highy[1] = j;
- set_high[1] = FALSE;
- }
- }
-#ifdef DEBUG
- else if (DB3)
- printf("0.00#%dx%da%2.1fb%2.1f\n",i,j,a,b);
-#endif
- }
-}
-
-
-
-int main(argc,argv)
-int argc;
-char *argv[];
-{ int k;
- int startx, starty;
- int endx, endy;
- int stride;
- int objects;
- int arg_index;
- char *scanfile=NULL;
- char *weightfile=NULL;
- char *trainfile1=NULL;
- char *trainfile2=NULL;
-
- if (argc<2)
- {
- goto Usage;
- }
- if (argc == 2)
- {
- if (strcmp(argv[1],"-v")==0)
- goto Version;
- else if (strcmp(argv[1],"-h")==0)
- goto Usage;
- }
-
- stride = 0;
- startx = 0;
- starty = 0;
- endy = 0;
- endx = 0;
- objects = 0;
-
- /* Read command line options */
- arg_index = 1;
- while (arg_index < argc-1)
- {
- if (strcmp(argv[arg_index],"-scanfile")==0)
- {
- scanfile= argv[arg_index+1];
- }
- else if (strcmp(argv[arg_index],"-weightfile")==0)
- {
- weightfile= argv[arg_index+1];
- }
- else if (strcmp(argv[arg_index],"-trainfile1")==0)
- {
- trainfile1= argv[arg_index+1];
- }
- else if (strcmp(argv[arg_index],"-trainfile2")==0)
- {
- trainfile2= argv[arg_index+1];
- }
- else if (strcmp(argv[arg_index],"-startx")==0)
- {
- startx = atoi(argv[arg_index+1]);
- }
- else if (strcmp(argv[arg_index],"-starty")==0)
- {
- starty = atoi(argv[arg_index+1]);
- }
- else if (strcmp(argv[arg_index],"-endx")==0)
- {
- endx = atoi(argv[arg_index+1]);
- }
- else if (strcmp(argv[arg_index],"-endy")==0)
- {
- endy = atoi(argv[arg_index+1]);
- }
- else if (strcmp(argv[arg_index],"-stride")==0)
- {
- stride = atoi(argv[arg_index+1]);
- }
- else if (strcmp(argv[arg_index],"-objects")==0)
- {
- objects = atoi(argv[arg_index+1]);
- }
- else
- {
- fprintf(stderr,"ERROR: Unknown option -> %s\n",argv[arg_index]);
- goto Usage;
- }
- arg_index+=2; /* this works as long as options are duals!!! */
- }
-
- /* Some basic error checking. */
-
- if (scanfile==NULL)
- {
- fprintf(stderr,"ERROR: Must specify input files\n");
- goto Usage;
- }
- if ((weightfile==NULL)&&(trainfile1==NULL))
- {
- fprintf(stderr,"ERROR: Must specify weightfile or trainfile1\n");
- goto Usage;
- }
- if ((weightfile!=NULL)&&(trainfile1!=NULL))
- {
- fprintf(stderr,"ERROR: Cannot specify weightfile and trainfile1\n");
- goto Usage;
- }
-
-#ifdef DEBUG
- fprintf(stdout,"scanfile = %s\n weightfile = %s\n startx = %d\n starty = %d\n stride = %d\n",scanfile,weightfile,startx,starty,stride);
-#endif
-
- loadimage(scanfile);
-
- /* Differentiate between loading pretrained network (load_weights)
- * and training. Currently, loading a pretrained network
- * supports only 1 object. If we train, we can learn to
- * recognize two objects.
- */
- if (weightfile!=NULL)
- {
- numpatterns = 1;
- if (objects==0)
- {
- objects = numpatterns;
- }
- load_weights(weightfile);
- init_globs(MODE_RECOGNIZE);
- init_net();
- }
- else
- {
- if (trainfile2!=NULL)
- {
- numpatterns = 2;
- if (objects<numpatterns)
- {
- objects = numpatterns;
- }
- load_train(trainfile1,MODE_TRAIN1,objects);
- alloc_td_bu();
- init_td(0);
- init_bu(0);
- resonant=k=0;
- while (!resonant)
- {
-#ifdef DEBUG
- fprintf(stdout,"k=%d\n",k);
-#endif
- train_match(0);
- k++;
- }
- load_train(trainfile2,MODE_TRAIN2,objects);
- init_globs(MODE_TRAIN2);
- init_td(1);
- init_bu(1);
- resonant=k=0;
- while (!resonant)
- {
-#ifdef DEBUG
- fprintf(stdout,"k=%d\n",k);
-#endif
- train_match(1);
- k++;
- }
- init_globs(MODE_RECOGNIZE);
- init_td(objects);
- init_bu(objects);
- sim_other_objects(numpatterns,objects,numf2s);
- setup_base_pattern(objects);
- }
- else
- {
- numpatterns = 1;
- if (objects<numpatterns)
- {
- objects = numpatterns;
- }
- load_train(trainfile1,MODE_TRAIN1,objects);
- alloc_td_bu();
- init_td(0);
- init_bu(0);
- resonant=k=0;
- while (!resonant)
- {
-#ifdef DEBUG
- fprintf(stdout,"k=%d\n",k);
-#endif
- train_match(0);
- k++;
- }
- init_globs(MODE_RECOGNIZE);
- init_td(1);
- init_bu(1);
- setup_base_pattern(1);
- }
- }
- /* Set endx and endy if user never specified */
- if (endy==0)
- {
- endy=height-lheight;
- }
- if (endx==0)
- {
- endx=width-lwidth;
- }
- highest_confidence[0] = 0.0;
- highest_confidence[1] = 0.0;
- highx[0] = 0;
- highx[1] = 0;
- highy[0] = 0;
- highy[1] = 0;
- set_high[0] = FALSE;
- set_high[1] = FALSE;
-
- scan_recognize(startx, starty, endx, endy, stride);
-
- fprintf(stdout,"Highest vigilance for 1 = %0.4f for object at X = %d, Y = %d\n", highest_confidence[0], highx[0], highy[0]);
- if (numpatterns==2) {
- fprintf(stdout,"Highest vigilance for 2 = %0.4f for object at X = %d, Y = %d\n", highest_confidence[1], highx[1], highy[1]);
- }
- return 0;
-Usage:
- fprintf(stderr,"Usage: scanner [-startx <num>] [-starty <num>] [-endx <num>] [-endy <num>] [-stride <num>] -scanfile <filename> -trainfile1 <filename> [-trainfile2 <filename>]\n");
- exit(0);
-Version:
- fprintf(stderr,"Version 1.00 \n");
- exit(1);
-}
+++ /dev/null
-#include <setjmp.h>
-
-int main(void) {
- jmp_buf buf;
- volatile int k = 0;
-
- int val = setjmp(buf);
- printf("Val: %d K: %d\n", val, k);
-
- k = 1;
- if(val == 0)
- longjmp(buf, 20);
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-#include <stdlib.h>
-#include <errno.h>
-#include <fcntl.h>
-#include <string.h>
-
-int dbglvl = 4;
-
-#define FUDGE_BUF (100*1024)
-#define MAX_SPEC_FD 2
-struct spec_fd_t {
- int limit;
- int len;
- int pos;
- unsigned char *buf;
-} spec_fd[MAX_SPEC_FD];
-
-int spec_init() {
- int i, j;
- !dbglvl;
-
- /* Allocate some large chunks of memory, we can tune this later */
- for (i = 0; i < MAX_SPEC_FD; i++) {
- spec_fd[i].buf = (unsigned char *) malloc(FUDGE_BUF);
- }
- return 0;
-}
-
-int spec_load(char *filename, int size) {
-#define FILE_CHUNK (128*1024)
- int fd, rc, i;
-#ifndef O_BINARY
-#define O_BINARY 0
-#endif
- fd = open(filename, O_RDONLY | O_BINARY);
- rc = read(fd, spec_fd[0].buf, FILE_CHUNK);
- if (rc < 0) {
- fprintf(stderr, "Error reading from %s: %s\n", filename,
- strerror(errno));
- exit(0);
- }
- close(fd);
- return 0;
-}
-
-#define MB (1024*1024)
-int main(int argc, char *argv[]) {
- int input_size = 64;
- char *input_name = "input.combined";
-
- spec_init();
-
- spec_load(input_name, input_size * MB);
-
- return 0;
-}
+++ /dev/null
-int printf(const char *str, ...);
-
-#define T unsigned
-#define tname(x) u_##x
-#include "shiftconst.h"
-#undef tname
-#undef T
-
-#define T int
-#define tname(x) i_##x
-#include "shiftconst.h"
-#undef tname
-#undef T
-
-#define T long long
-#define tname(x) ll_##x
-#include "shiftconst.h"
-#undef tname
-#undef T
-
-#define T signed char
-#define tname(x) sc_##x
-#include "shiftconst.h"
-#undef tname
-#undef T
-
-int main(void)
-{
-#define TEST(x) printf(#x "(0xAABBCCDD) = 0x%X\n", x(0xAABBCCDD))
-#define ALLTESTS(pf) \
- TEST(pf##k1); \
- TEST(pf##k2); \
- TEST(pf##k3); \
- TEST(pf##k4); \
- TEST(pf##k5); \
- TEST(pf##k6); \
- TEST(pf##k7); \
- TEST(pf##k8);
-
- ALLTESTS(u_);
- ALLTESTS(i_);
- ALLTESTS(ll_);
- ALLTESTS(sc_);
- return 0;
-}
+++ /dev/null
-T tname(k1) (T x) {
- return (x << 5) >> 24;
-}
-
-T tname(k2) (T x) {
- return (x >> 5) << 24;
-}
-
-T tname(k3) (T x) {
- return (x << 20) >> 20;
-}
-
-T tname(k4) (T x) {
- return (x & 0xfff0) >> 8;
-}
-
-T tname(k5) (T x) {
- unsigned short l = 24;
- return (x << 5) >> l;
-}
-
-T tname(k6) (T x) {
- return (x & 0xff) >> 8;
-}
-
-T tname(k7) (T x) {
- return (x >> 10) << 5;
-}
-
-T tname(k8) (T x) {
- return (x >> 10) << 5;
-}
+++ /dev/null
-#include <stdio.h>
-
-unsigned int sse8_16bit_c( const int * b1,
- const int * b2,
- const unsigned int stride)
-{
- int i;
- int sse = 0;
-
- for (i=0; i<8; i++) {
- sse += (b1[0] - b2[0])*(b1[0] - b2[0]);
- sse += (b1[1] - b2[1])*(b1[1] - b2[1]);
- sse += (b1[2] - b2[2])*(b1[2] - b2[2]);
- sse += (b1[3] - b2[3])*(b1[3] - b2[3]);
- sse += (b1[4] - b2[4])*(b1[4] - b2[4]);
- sse += (b1[5] - b2[5])*(b1[5] - b2[5]);
- sse += (b1[6] - b2[6])*(b1[6] - b2[6]);
- sse += (b1[7] - b2[7])*(b1[7] - b2[7]);
-
- b1 = (const int*)((char*)b1+stride);
- b2 = (const int*)((char*)b2+stride);
- }
-
- return(sse);
-}
-
-#define MAX 65536
-
-int main(){
- int cur[MAX];
- int ref[MAX];
- int sum = 0;
- int numofruns = 10;
- int i,ii;
- for (i=0;i < numofruns; i++){
- // Reset cache. Alles andere ist unrealistisch.
- for(ii = 0; ii<MAX;ii++){
- cur[ii]=(ii)&0xff;
- ref[ii]=(ii+i+3)&0xff;
- }
- sum = sse8_16bit_c(cur, ref, 32);
- printf("sum[%i] = %i\n",i, sum);
- }
- return 0 ;
-}
+++ /dev/null
-#include <stdio.h>
-
-#define ITERS 8
-
-unsigned int sse8_16bit_c( const short * b1,
- const short * b2,
- const unsigned int stride)
-{
- int i;
- int sse = 0;
-
- for (i=0; i<ITERS; i++) {
- sse += (b1[0] - b2[0])*(b1[0] - b2[0]);
- sse += (b1[1] - b2[1])*(b1[1] - b2[1]);
- sse += (b1[2] - b2[2])*(b1[2] - b2[2]);
- sse += (b1[3] - b2[3])*(b1[3] - b2[3]);
- sse += (b1[4] - b2[4])*(b1[4] - b2[4]);
- sse += (b1[5] - b2[5])*(b1[5] - b2[5]);
- sse += (b1[6] - b2[6])*(b1[6] - b2[6]);
- sse += (b1[7] - b2[7])*(b1[7] - b2[7]);
-
- b1 = (const short*)((char*)b1+stride);
- b2 = (const short*)((char*)b2+stride);
- }
-
- return(sse);
-}
-
-#define STRIDE 16
-//#define MAX 65536
-#define MAX (ITERS * STRIDE)
-
-int main(int argc, char** argv){
- short cur[MAX];
- short ref[MAX];
- int sum = 0;
- int numofruns = 10;
- int i,ii;
-
- if(argc > 1) {
- numofruns = atoi(argv[1]);
- }
-
- for (i=0;i < numofruns; i++){
- // Reset cache. Alles andere ist unrealistisch.
- for(ii = 0; ii < MAX; ++ii) {
- cur[ii]=(ii)&0xff;
- ref[ii]=(ii+i+3)&0xff;
- }
- sum = sse8_16bit_c(cur, ref, STRIDE);
- if(i < 10)
- printf("sum[%i] = %i\n",i, sum);
- }
-
- return 0 ;
-}
+++ /dev/null
-#include <stdio.h>
-
-#define abs(X) (((X)>0)?(X):-(X))
-
-unsigned int sad16_c( const unsigned char * const cur,
- const unsigned char * const ref,
- const unsigned int stride,
- const unsigned int best_sad)
-{
-
- unsigned int sad = 0;
- unsigned int j;
- unsigned char const *ptr_cur = cur;
- unsigned char const *ptr_ref = ref;
-
- for (j = 0; j < 16; j++) {
- sad += abs(ptr_cur[0] - ptr_ref[0]);
- sad += abs(ptr_cur[1] - ptr_ref[1]);
- sad += abs(ptr_cur[2] - ptr_ref[2]);
- sad += abs(ptr_cur[3] - ptr_ref[3]);
- sad += abs(ptr_cur[4] - ptr_ref[4]);
- sad += abs(ptr_cur[5] - ptr_ref[5]);
- sad += abs(ptr_cur[6] - ptr_ref[6]);
- sad += abs(ptr_cur[7] - ptr_ref[7]);
- sad += abs(ptr_cur[8] - ptr_ref[8]);
- sad += abs(ptr_cur[9] - ptr_ref[9]);
- sad += abs(ptr_cur[10] - ptr_ref[10]);
- sad += abs(ptr_cur[11] - ptr_ref[11]);
- sad += abs(ptr_cur[12] - ptr_ref[12]);
- sad += abs(ptr_cur[13] - ptr_ref[13]);
- sad += abs(ptr_cur[14] - ptr_ref[14]);
- sad += abs(ptr_cur[15] - ptr_ref[15]);
-
-
- if (sad >= best_sad)
- return sad;
-
- ptr_cur += stride;
- ptr_ref += stride;
-
- }
-
- return sad;
-
-}
-
-int main(int argc, char** argv){
- unsigned char cur[65536];
- unsigned char ref[65536];
- int sum = 0;
- int numofruns = 100;
- int i,ii;
-
- if(argc > 1) {
- numofruns = atoi(argv[1]);
- }
-
- for (i=0;i < numofruns; i++){
- // Reset cache. Alles andere ist unrealistisch.
- for(ii = 0; ii<65536;ii++){
- cur[ii]=ii&0xff;
- ref[ii]=(ii+4)&0xff;
- }
- sum += sad16_c(cur, ref, 64, 100000);
- }
- printf("sum = %i\n", sum);
- return 0 ;
-}
+++ /dev/null
-int main(void) {
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-unsigned m = 7;
-
-int main(void) {
-
- unsigned a;
- unsigned c = 0;
-
- for (a=0; a<=m; a++) {
- c = a;
- }
-
- printf("%d %d\n", a, c);
-
- return 0;
-}
+++ /dev/null
-struct x {
- int a;
- int b;
- int c;
- int d;
-};
-
-struct y {
- int a;
- int b;
- int c;
- int d[20];
-};
-
-int main()
-{
- struct x A;
- struct y B;
-
- A.a = 3;
- A.b = 4;
- A.c = 5;
- A.d = 6;
-
- B.a = 4;
- B.b = 5;
- B.c = 6;
-
- printf("%d\n", t(A));
- printf("%d\n", z(B));
-
- return 0;
-}
-
-int t(struct x x)
-{
- return x.b;
-}
-
-int z(struct y x)
-{
- return x.c;
-}
+++ /dev/null
-typedef struct _foo_t {
- int a;
- char b;
-} foo_t;
-
-foo_t sret_func(int c) {
- foo_t x;
- x.a = c;
- x.b = 0;
- return x;
-}
-
-int main(int argc) {
- foo_t z;
-
- z.b = 13;
- z = sret_func(argc);
-
- return z.b;
-}
+++ /dev/null
-#include <stdio.h>
-
-#define maxint(a,b) \
- ({int _a = (a), _b = (b); _a > _b ? _a : _b; })
-
-int main(int argc, char *argv[])
-{
- int i = argc + 3;
- int j = argc * argc;
-
- printf("max %d, %d = %d\n", i, j, maxint(i,j));
-
- return 0;
-}
+++ /dev/null
-extern int x;
-int x;
-
-int main()
-{
- int i = 0;
-
- x = 0;
- do {
- x = x + i;
- ++i;
- } while(i < 3);
-
- return x != 3;
-}
+++ /dev/null
-#include <stdio.h>
-
-int main()
-{
- int i;
-
- for (i = 0; i < 10; ++i) {
- printf("%d\n", i * 4);
- }
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-struct A {
- int x;
-};
-
-struct B {
- int y;
- struct A a1;
- struct A a2;
-} b = { 1, 2, 3 };
-
-struct C {
- char s;
- int d[3];
-} c = { 'q', { 4, 5, 6 } };
-
-int e[3] = { 7, 8, 9 };
-
-struct X {
- char c;
-} x = { 'w' };
-
-struct N {
- struct C foo[3];
- char c;
- struct B b;
-} n = { '1', { 10, 11, 12 },
- '2', { 13, 14, 15 },
- '3', { 16, 17, 18 },
- 'c',
- { 19, 20, 21 }
- };
-
-int md[5][4][3] = { { { 22, 23, 24 }, { 25, 26, 27 }, { 28, 29, 30 }, { 31, 32, 33 } },
- { { 34, 35, 36 }, { 37, 38, 39 }, { 40, 41, 42 }, { 43, 44, 45 } },
- { { 46, 47, 48 }, { 49, 50, 51 }, { 52, 53, 54 }, { 55, 56, 57 } },
- { { 58, 59, 60 }, { 61, 62, 63 }, { 64, 65, 66 }, { 67, 68, 69 } },
- { { 70, 71, 72 }, { 73, 74, 75 }, { 76, 77, 78 }, { 79, 80, 81 } },
- };
-
-struct G {
- char z1;
- int k[2][2][2];
- char z2;
-} g = {
- 'u',
- { { { 82, 83 }, { 84, 85 } }, { { 86, 87 }, { 88, 89 } } },
- 'v'
- };
-
-struct X xarr[] = { { 'H' }, { 'e' }, { 'l' }, { 'l' }, { 'o' }, { ' ' }, { 'W' }, { 'o' }, { 'r' }, { 'l' }, { 'd' }, { '!' }, { '\n' } } ;
-
-struct C carr[] = {
- { 'k', { 90, 91, 92 } },
- { 'm', { 93, 94, 95 } },
- { 'n', { 96, 97, 98 } }
- };
-
-int main(void) {
- int i = 0;
-
- printf("expected 1 2 3\nfound %d %d %d\n\n", b.y, b.a1.x, b.a2.x);
-
- printf("expected q 4 5 6\nfound %c %d %d %d\n\n", c.s, c.d[0], c.d[1], c.d[2]);
-
- printf("expected 7 8 9\nfound %d %d %d\n\n", e[0], e[1], e[2]);
-
- printf("expected w\nfound %c\n\n", x.c);
-
- printf("expected 0\nfound %d\n\n", i);
-
- printf("expected 1 10 11 12 | 2 13 14 15 | 3 16 17 18 | c | 19 20 21\nfound %c %d %d %d | %c %d %d %d | %c %d %d %d | %c | %d %d %d\n\n",
- n.foo[0].s, n.foo[0].d[0], n.foo[0].d[1], n.foo[0].d[2],
- n.foo[1].s, n.foo[1].d[0], n.foo[1].d[1], n.foo[1].d[2],
- n.foo[2].s, n.foo[2].d[0], n.foo[2].d[1], n.foo[2].d[2],
- n.c, n.b.y, n.b.a1.x, n.b.a2.x);
-
- printf("expected numbers 22-81: %d %d %d | %d %d %d | %d %d %d | %d %d %d\n", md[0][0][0], md[0][0][1], md[0][0][2],
- md[0][1][0], md[0][1][1], md[0][1][2],
- md[0][2][0], md[0][2][1], md[0][2][2],
- md[0][3][0], md[0][3][1], md[0][3][2]);
- printf(" %d %d %d | %d %d %d | %d %d %d | %d %d %d\n", md[1][0][0], md[1][0][1], md[1][0][2],
- md[1][1][0], md[1][1][1], md[1][1][2],
- md[1][2][0], md[1][2][1], md[1][2][2],
- md[1][3][0], md[1][3][1], md[1][3][2]);
- printf(" %d %d %d | %d %d %d | %d %d %d | %d %d %d\n", md[2][0][0], md[2][0][1], md[2][0][2],
- md[2][1][0], md[2][1][1], md[2][1][2],
- md[2][2][0], md[2][2][1], md[2][2][2],
- md[2][3][0], md[2][3][1], md[2][3][2]);
- printf(" %d %d %d | %d %d %d | %d %d %d | %d %d %d\n", md[3][0][0], md[3][0][1], md[3][0][2],
- md[3][1][0], md[3][1][1], md[3][1][2],
- md[3][2][0], md[3][2][1], md[3][2][2],
- md[3][3][0], md[3][3][1], md[3][3][2]);
- printf(" %d %d %d | %d %d %d | %d %d %d | %d %d %d\n", md[4][0][0], md[4][0][1], md[4][0][2],
- md[4][1][0], md[4][1][1], md[4][1][2],
- md[4][2][0], md[4][2][1], md[4][2][2],
- md[4][3][0], md[4][3][1], md[4][3][2]);
-
- printf("\nexpected u | 82 83 | 84 85 | 86 87 | 88 89 | v\nfound %c | %d %d | %d %d | %d %d | %d %d | %c\n\n", g.z1, g.k[0][0][0],
- g.k[0][0][1], g.k[0][1][0], g.k[0][1][1], g.k[1][0][0], g.k[1][0][1], g.k[1][1][0], g.k[1][1][1], g.z2);
-
- printf("expected Hello World!\nfound ");
- for (i = 0; i < sizeof(xarr); i++) printf("%c", xarr[i].c);
-
- printf("\nexpected k 90 91 92 | m 93 94 95 | n 96 97 98\nfound %c %d %d %d | %c %d %d %d | %c %d %d %d\n",
- carr[0].s, carr[0].d[0], carr[0].d[1], carr[0].d[2], carr[1].s, carr[1].d[0], carr[1].d[1], carr[1].d[2],
- carr[2].s, carr[2].d[0], carr[2].d[1], carr[2].d[2]);
-
- return 0;
-}
+++ /dev/null
-struct A {
- int a;
- int b;
-};
-
-static int test(struct A arg) {
- return arg.a + arg.b;
-}
-
-int main(int argc, char *argv[]) {
- struct A a;
-
- a.a = 3;
- a.b = 4;
-
- printf("Sum = %d\n", test(a));
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-struct A {
- int x;
- int y;
-};
-
-int main(int argc, char *argv[])
-{
- struct A a;
-
- printf("structtest.c\n");
-
- printf("sizeof struct(A) %ld\n", sizeof(struct A));
- printf("sizeof a %ld\n", sizeof(a));
-
- a.x = 3;
- a.y = 4;
-
- printf("a.x = %d (should be 3)\n", a.x);
- printf("a.y = %d (should be 4)\n", a.y);
-
- return 0;
-}
+++ /dev/null
-#include <assert.h>
-#include <limits.h>
-
-static int switch1(int k) {
- switch(k) {
- case 42:
- return 5;
- case 13:
- return 7;
- case INT_MAX:
- return 8;
- case -1:
- case INT_MIN:
- return 9;
- }
- return 3;
-}
-
-int main(void)
-{
- assert(switch1(42) == 5);
- assert(switch1(13) == 7);
- assert(switch1(-1) == 9);
- assert(switch1(700) == 3);
- assert(switch1(-32000) == 3);
- assert(switch1(INT_MAX) == 8);
- assert(switch1(INT_MIN) == 9);
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-int test(int a)
-{
- int b = 0xff;
-
- switch (a * b) {
- case 0:
- b *= a;
- case 1:
- b *= a;
- ++b;
- break;
- case 2:
- b /= a;
- break;
- case 3:
- b *= a*a;
- break;
- case 4:
- b = a % 3;
- break;
- case 5:
- b = 2;
- break;
- default:
- return 0;
- }
- return b;
-}
-
-int main()
-{
- printf("SwitchTest\n");
- printf(" on %d %d\n", -1, test(-1));
- printf(" on %d %d\n", 0, test(0));
- printf(" on %d %d\n", 1, test(1));
- printf(" on %d %d\n", 2, test(2));
- printf(" on %d %d\n", 3, test(3));
- printf(" on %d %d\n", 4, test(4));
- printf(" on %d %d\n", 5, test(5));
- printf(" on %d %d\n", 6, test(6));
-
- return 0;
-}
+++ /dev/null
-static int test2(int a)
-{
- int b = 0xff;
-
- switch (a * b) {
- case 0:
- b *= a;
- case 1:
- b *= a;
- ++b;
- break;
- case 2:
- b /= a;
- break;
- case 3:
- b *= a*a;
- break;
- case 4:
- b = a % 3;
- break;
- case 10000:
- b = 2;
- break;
- default:
- return 0;
- }
- return b;
-}
-
-int main()
-{
- printf("SwitchTest\n");
- printf(" on %d %d\n", -1, test2(-1));
- printf(" on %d %d\n", 0, test2(0));
- printf(" on %d %d\n", 1, test2(1));
- printf(" on %d %d\n", 2, test2(2));
- printf(" on %d %d\n", 3, test2(3));
- printf(" on %d %d\n", 4, test2(4));
- printf(" on %d %d\n", 5, test2(5));
- printf(" on %d %d\n", 6, test2(6));
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-static unsigned fak(unsigned n)
-{
- if (n == 0)
- return 1;
-
- return n * fak(n - 1);
-}
-
-
-int main(int argc, char *argv[])
-{
- int x = 4;
-
- printf("%d! = %d\n", x, fak(x));
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-#include <stdlib.h>
-
-unsigned fak(unsigned n) {
- if (n == 0)
- return 1;
- return fak(n-1) * n;
-}
-
-int main(int argc, char *argv[]) {
- unsigned v = 7;
-
- if (argc > 1)
- v = atoi(argv[1]);
- printf("%u! = %u\n", v, fak(v));
-}
+++ /dev/null
-/*
- * TCC auto test program
- */
-//#include "config.h"
-#include <stdio.h>
-#include <stdlib.h>
-#include <stdarg.h>
-
-#if GCC_MAJOR >= 3
-
-/* Unfortunately, gcc version < 3 does not handle that! */
-#define ALL_ISOC99
-
-/* only gcc 3 handles _Bool correctly */
-#define BOOL_ISOC99
-
-/* gcc 2.95.3 does not handle correctly CR in strings or after strays */
-/* Matze: removed this test as I couldn't committ it to svn... */
-/* #define CORRECT_CR_HANDLING */
-
-#endif
-
-/* deprecated and no longer supported in gcc 3.3 */
-//#define ACCEPT_CR_IN_STRINGS
-
-/* __VA_ARGS__ and __func__ support */
-#define C99_MACROS
-
-/* test various include syntaxes */
-
-#define TCCLIB_INC <tcclib.h>
-#define TCCLIB_INC1 <tcclib
-#define TCCLIB_INC2 h>
-#define TCCLIB_INC3 "tcclib"
-
-#include TCCLIB_INC
-
-#include TCCLIB_INC1.TCCLIB_INC2
-
-#include TCCLIB_INC1.h>
-
-/* gcc 3.2 does not accept that (bug ?) */
-//#include TCCLIB_INC3 ".h"
-
-#include "tcclib.h"
-
-#include <tcclib.h>
-
-void string_test();
-void expr_test();
-void macro_test();
-void scope_test();
-void forward_test();
-void funcptr_test();
-void loop_test();
-void switch_test();
-void goto_test();
-void enum_test();
-void typedef_test();
-void struct_test();
-void array_test();
-void expr_ptr_test();
-void bool_test();
-void expr2_test();
-void constant_expr_test();
-void expr_cmp_test();
-void char_short_test();
-void init_test(void);
-void compound_literal_test(void);
-int kr_test();
-void struct_assign_test(void);
-void cast_test(void);
-void bitfield_test(void);
-void c99_bool_test(void);
-void float_test(void);
-void longlong_test(void);
-void stdarg_test(void);
-void whitespace_test(void);
-void relocation_test(void);
-void old_style_function(void);
-void sizeof_test(void);
-void typeof_test(void);
-void local_label_test(void);
-void statement_expr_test(void);
-void asm_test(void);
-void builtin_test(void);
-void static_test(void);
-
-int fib(int n);
-void num(int n);
-void forward_ref(void);
-int isid(int c);
-
-#define A 2
-#define N 1234 + A
-#define pf printf
-#define M1(a, b) (a) + (b)
-
-#define str\
-(s) # s
-#define glue(a, b) a ## b
-#define xglue(a, b) glue(a, b)
-#define HIGHLOW "hello"
-#define LOW LOW ", world"
-
-#define min(a, b) ((a) < (b) ? (a) : (b))
-
-#ifdef C99_MACROS
-#define dprintf(level,...) printf(__VA_ARGS__)
-#endif
-
-/* gcc vararg macros */
-#define dprintf1(level, fmt, args...) printf(fmt, ## args)
-
-#define MACRO_NOARGS()
-
-#define AAA 3
-#undef AAA
-#define AAA 4
-
-#if 1
-#define B3 1
-#elif 1
-#define B3 2
-#elif 0
-#define B3 3
-#else
-#define B3 4
-#endif
-
-#define __INT64_C(c) c ## LL
-#define INT64_MIN (-__INT64_C(9223372036854775807)-1)
-
-int qq(int x)
-{
- return x + 40;
-}
-#define qq(x) x
-
-#define spin_lock(lock) do { } while (0)
-#define wq_spin_lock spin_lock
-#define TEST2() wq_spin_lock(a)
-
-void macro_test(void)
-{
- printf("macro:\n");\f\v
- pf("N=%d\n", N);
- printf("aaa=%d\n", AAA);
-
- printf("min=%d\n", min(1, min(2, -1)));
-
- printf("s1=%s\n", glue(HIGH, LOW));
- printf("s2=%s\n", xglue(HIGH, LOW));
- printf("s3=%s\n", str("c"));
- printf("s4=%s\n", str(a1));
- printf("B3=%d\n", B3);
-
-#ifdef A
- printf("A defined\n");
-#endif
-#ifdef B
- printf("B defined\n");
-#endif
-#ifdef A
- printf("A defined\n");
-#else
- printf("A not defined\n");
-#endif
-#ifdef B
- printf("B defined\n");
-#else
- printf("B not defined\n");
-#endif
-
-#ifdef A
- printf("A defined\n");
-#ifdef B
- printf("B1 defined\n");
-#else
- printf("B1 not defined\n");
-#endif
-#else
- printf("A not defined\n");
-#ifdef B
- printf("B2 defined\n");
-#else
- printf("B2 not defined\n");
-#endif
-#endif
-
-#if 1+1
- printf("test true1\n");
-#endif
-#if 0
- printf("test true2\n");
-#endif
-#if 1-1
- printf("test true3\n");
-#endif
-#if defined(A)
- printf("test trueA\n");
-#endif
-#if defined(B)
- printf("test trueB\n");
-#endif
-
-#if 0
- printf("test 0\n");
-#elif 0
- printf("test 1\n");
-#elif 2
- printf("test 2\n");
-#else
- printf("test 3\n");
-#endif
-
- MACRO_NOARGS();
-
-#ifdef __LINE__
- printf("__LINE__ defined\n");
-#endif
-
- printf("__LINE__=%d __FILE__=%s\n",
- __LINE__, __FILE__);
-#line 200
- printf("__LINE__=%d __FILE__=%s\n",
- __LINE__, __FILE__);
-#line 203 "test"
- printf("__LINE__=%d __FILE__=%s\n",
- __LINE__, __FILE__);
-#line 220 "tcctest.c"
-
- /* not strictly preprocessor, but we test it there */
-#ifdef C99_MACROS
- printf("__func__ = %s\n", __func__);
- dprintf(1, "vaarg=%d\n", 1);
-#endif
- dprintf1(1, "vaarg1\n");
- dprintf1(1, "vaarg1=%d\n", 2);
- dprintf1(1, "vaarg1=%d %d\n", 1, 2);
-
- /* gcc extension */
- printf("func='%s'\n", __FUNCTION__);
-
- /* complicated macros in glibc */
- printf("INT64_MIN=%Ld\n", INT64_MIN);
- {
- int a;
- a = 1;
- glue(a+, +);
- printf("a=%d\n", a);
- glue(a <, <= 2);
- printf("a=%d\n", a);
- }
-
- /* macro function with argument outside the macro string */
-#define MF_s MF_hello
-#define MF_hello(msg) printf("%s\n",msg)
-
-#define MF_t printf("tralala\n"); MF_hello
-
- MF_s("hi");
- MF_t("hi");
-
- /* test macro substituion inside args (should not eat stream) */
- printf("qq=%d\n", qq(qq)(2));
-
- /* test zero argument case. NOTE: gcc 2.95.x does not accept a
- null argument without a space. gcc 3.2 fixes that. */
-
-#define qq1(x) 1
- printf("qq1=%d\n", qq1( ));
-
- /* comment with stray handling *\
-/
- /* this is a valid *\/ comment */
- /* this is a valid comment *\*/
- // this is a valid\
-comment
-
- /* test function macro substitution when the function name is
- substituted */
- TEST2();
-
-#define PART_ONE(n) (!!((n) & 0xF))
-#define PART_TWO(n) (PART_ONE(n))
-#define PART_THREE(f) PART_TWO(0x##f##U)
- printf("Nested macros: %d == 0\n", PART_THREE(0));
-
-}
-
-int some_fn(int x)
-{
- return x;
-}
-
-int other_fn(int x)
-{
- return x*2;
-}
-
-int op(a,b)
-{
- return a / b;
-}
-
-int ret(a)
-{
- if (a == 2)
- return 1;
- if (a == 3)
- return 2;
- return 0;
-}
-
-void ps(const char *s)
-{
- int c;
- while (1) {
- c = *s;
- if (c == 0)
- break;
- printf("%c", c);
- s++;
- }
-}
-
-const char foo1_string[] = "\
-bar\n\
-test\14\
-1";
-
-void string_test()
-{
- int b;
- printf("string:\n");
- printf("\141\1423\143\n");/* dezdez test */
- printf("\x41\x42\x43\x3a\n");
- printf("c=%c\n", 'r');
- printf("wc=%C 0x%lx %C\n", L'a', L'\x1234', L'c');
- printf("foo1_string='%s'\n", foo1_string);
-#if 0
- printf("wstring=%S\n", L"abc");
- printf("wstring=%S\n", L"abc" L"def" "ghi");
- printf("'\\377'=%d '\\xff'=%d\n", '\377', '\xff');
- printf("L'\\377'=%d L'\\xff'=%d\n", L'\377', L'\xff');
-#endif
- ps("test\n");
- b = 32;
- while ((b = b + 1) < 96) {
- printf("%c", b);
- }
- printf("\n");
- printf("fib=%d\n", fib(33));
- b = 262144;
- while (b != 0x80000000) {
- num(b);
- b = b * 2;
- }
-}
-
-void loop_test()
-{
- int i;
- i = 0;
- while (i < 10)
- printf("%d", i++);
- printf("\n");
- for(i = 0; i < 10;i++)
- printf("%d", i);
- printf("\n");
- i = 0;
- do {
- printf("%d", i++);
- } while (i < 10);
- printf("\n");
-
- /* break/continue tests */
- i = 0;
- while (1) {
- if (i == 6)
- break;
- i++;
- if (i == 3)
- continue;
- printf("%d", i);
- }
- printf("\n");
-
- /* break/continue tests */
- i = 0;
- do {
- if (i == 6)
- break;
- i++;
- if (i == 3)
- continue;
- printf("%d", i);
- } while(1);
- printf("\n");
-
- for(i = 0;i < 10;i++) {
- if (i == 3)
- continue;
- printf("%d", i);
- }
- printf("\n");
-}
-
-
-void goto_test()
-{
- int i;
- static void *label_table[3] = { &&label1, &&label2, &&label3 };
-
- printf("goto:\n");
- i = 0;
- s_loop:
- if (i >= 10)
- goto s_end;
- printf("%d", i);
- i++;
- goto s_loop;
- s_end:
- printf("\n");
-
- /* we also test computed gotos (GCC extension) */
- for(i=0;i<3;i++) {
- goto *label_table[i];
- label1:
- printf("label1\n");
- goto next;
- label2:
- printf("label2\n");
- goto next;
- label3:
- printf("label3\n");
- next: ;
- }
-}
-
-enum {
- E0,
- E1 = 2,
- E2 = 4,
- E3,
- E4,
-};
-
-enum test {
- E5 = 1000,
-};
-
-void enum_test()
-{
- enum test b1;
- printf("enum:\n%d %d %d %d %d %d\n",
- E0, E1, E2, E3, E4, E5);
- b1 = 1;
- printf("b1=%d\n", b1);
-}
-
-typedef int *my_ptr;
-
-void typedef_test()
-{
- my_ptr a;
- int b;
- a = &b;
- *a = 1234;
- printf("typedef:\n");
- printf("a=%d\n", *a);
-}
-
-void forward_test()
-{
- printf("forward:\n");
- forward_ref();
- forward_ref();
-}
-
-
-void forward_ref(void)
-{
- printf("forward ok\n");
-}
-
-typedef struct struct1 {
- int f1;
- int f2, f3;
- union union1 {
- int v1;
- int v2;
- } u;
- char str[3];
-} struct1;
-
-struct struct2 {
- int a;
- char b;
-};
-
-union union2 {
- int w1;
- int w2;
-};
-
-struct struct1 st1, st2;
-
-int main(int argc, char **argv)
-{
- string_test();
- expr_test();
- macro_test();
- scope_test();
- forward_test();
- funcptr_test();
- loop_test();
- switch_test();
- goto_test();
- enum_test();
- typedef_test();
- struct_test();
- array_test();
- expr_ptr_test();
- bool_test();
- expr2_test();
- constant_expr_test();
- expr_cmp_test();
- char_short_test();
- init_test();
- compound_literal_test();
- kr_test();
- struct_assign_test();
- cast_test();
- bitfield_test();
- c99_bool_test();
- float_test();
- longlong_test();
- stdarg_test();
- whitespace_test();
- relocation_test();
- old_style_function();
- sizeof_test();
- typeof_test();
- statement_expr_test();
- local_label_test();
- asm_test();
- builtin_test();
- static_test();
- return 0;
-}
-
-int tab[3];
-int tab2[3][2];
-
-int g;
-
-void f1(g)
-{
- printf("g1=%d\n", g);
-}
-
-void scope_test()
-{
- printf("scope:\n");
- g = 2;
- f1(1);
- printf("g2=%d\n", g);
- {
- int g;
- g = 3;
- printf("g3=%d\n", g);
- {
- int g;
- g = 4;
- printf("g4=%d\n", g);
- }
- }
- printf("g5=%d\n", g);
-}
-
-void array_test(int a[4])
-{
- int i, j;
-
- printf("array:\n");
- printf("sizeof(a) = %d\n", sizeof(a));
- printf("sizeof(\"a\") = %d\n", sizeof("a"));
-#ifdef C99_MACROS
- printf("sizeof(__func__) = %d\n", sizeof(__func__));
-#endif
- printf("sizeof tab %d\n", sizeof(tab));
- printf("sizeof tab2 %d\n", sizeof tab2);
- tab[0] = 1;
- tab[1] = 2;
- tab[2] = 3;
- printf("%d %d %d\n", tab[0], tab[1], tab[2]);
- for(i=0;i<3;i++)
- for(j=0;j<2;j++)
- tab2[i][j] = 10 * i + j;
- for(i=0;i<3*2;i++) {
- printf(" %3d", ((int *)tab2)[i]);
- }
- printf("\n");
-}
-
-void expr_test()
-{
- int a, b;
- a = 0;
- printf("%d\n", a += 1);
- printf("%d\n", a -= 2);
- printf("%d\n", a *= 31232132);
- printf("%d\n", a /= 4);
- printf("%d\n", a %= 20);
- printf("%d\n", a &= 6);
- printf("%d\n", a ^= 7);
- printf("%d\n", a |= 8);
- printf("%d\n", a >>= 3);
- printf("%d\n", a <<= 4);
-
- a = 22321;
- b = -22321;
- printf("%d\n", a + 1);
- printf("%d\n", a - 2);
- printf("%d\n", a * 312);
- printf("%d\n", a / 4);
- printf("%d\n", b / 4);
- printf("%d\n", (unsigned)b / 4);
- printf("%d\n", a % 20);
- printf("%d\n", b % 20);
- printf("%d\n", (unsigned)b % 20);
- printf("%d\n", a & 6);
- printf("%d\n", a ^ 7);
- printf("%d\n", a | 8);
- printf("%d\n", a >> 3);
- printf("%d\n", b >> 3);
- printf("%d\n", (unsigned)b >> 3);
- printf("%d\n", a << 4);
- printf("%d\n", ~a);
- printf("%d\n", -a);
- printf("%d\n", +a);
-
- printf("%d\n", 12 + 1);
- printf("%d\n", 12 - 2);
- printf("%d\n", 12 * 312);
- printf("%d\n", 12 / 4);
- printf("%d\n", 12 % 20);
- printf("%d\n", 12 & 6);
- printf("%d\n", 12 ^ 7);
- printf("%d\n", 12 | 8);
- printf("%d\n", 12 >> 2);
- printf("%d\n", 12 << 4);
- printf("%d\n", ~12);
- printf("%d\n", -12);
- printf("%d\n", +12);
- printf("%d %d %d %d\n",
- isid('a'),
- isid('g'),
- isid('T'),
- isid('('));
-
- {
- /* Check that tcc saves registers before a conditional jump */
- /* Addresses bug "grischka case_2" */
- struct test_str { int a, b, c; };
- struct test_str t1 = {0,0,0};
- struct test_str t2 = {1,1,1};
- struct test_str *p1 = &t1;
- struct test_str *p2 = &t2;
- int f = 0;
- int g = 0;
-
- p1->b = f==0 || isid(0);
- printf("case_2.1: Expect 0 1 0 -> %d %d %d\n", p1->a, p1->b, p1->c);
- p1->c = !f || isid(0);
- printf("case_2.2: Expect 0 1 1 -> %d %d %d\n", p1->a, p1->b, p1->c);
-
- /* This will crash old versions of tcc during compilation: */
- p2->b = (f==1) && isid(0);
- printf("case_2.1AND: Expect 0 1 0 -> %d %d %d\n", p2->a, p2->b, p2->c);
- p2->b = (!(f==1)) && isid(0);
- printf("case_2.2AND: Expect 0 1 0 -> %d %d %d\n", p2->a, p2->b, p2->c);
- }
-}
-
-int isid(int c)
-{
- return (c >= 'a' & c <= 'z') | (c >= 'A' & c <= 'Z') | c == '_';
-}
-
-/**********************/
-
-int vstack[10], *vstack_ptr;
-
-void vpush(int vt, int vc)
-{
- *vstack_ptr++ = vt;
- *vstack_ptr++ = vc;
-}
-
-void vpop(int *ft, int *fc)
-{
- *fc = *--vstack_ptr;
- *ft = *--vstack_ptr;
-}
-
-void expr2_test()
-{
- int a, b;
-
- printf("expr2:\n");
- vstack_ptr = vstack;
- vpush(1432432, 2);
- vstack_ptr[-2] &= ~0xffffff80;
- vpop(&a, &b);
- printf("res= %d %d\n", a, b);
-}
-
-void constant_expr_test()
-{
- int a;
- printf("constant_expr:\n");
- a = 3;
- printf("%d\n", a * 16);
- printf("%d\n", a * 1);
- printf("%d\n", a + 0);
-}
-
-int tab4[10];
-
-void expr_ptr_test()
-{
- int *p, *q;
-
- printf("expr_ptr:\n");
- p = tab4;
- q = tab4 + 10;
- printf("diff=%d\n", q - p);
- p++;
- printf("inc=%d\n", p - tab4);
- p--;
- printf("dec=%d\n", p - tab4);
- ++p;
- printf("inc=%d\n", p - tab4);
- --p;
- printf("dec=%d\n", p - tab4);
- printf("add=%d\n", p + 3 - tab4);
- printf("add=%d\n", 3 + p - tab4);
-}
-
-void expr_cmp_test()
-{
- int a, b;
- printf("constant_expr:\n");
- a = -1;
- b = 1;
- printf("%d\n", a == a);
- printf("%d\n", a != a);
-
- printf("%d\n", a < b);
- printf("%d\n", a <= b);
- printf("%d\n", a <= a);
- printf("%d\n", b >= a);
- printf("%d\n", a >= a);
- printf("%d\n", b > a);
-
- printf("%d\n", (unsigned)a < b);
- printf("%d\n", (unsigned)a <= b);
- printf("%d\n", (unsigned)a <= a);
- printf("%d\n", (unsigned)b >= a);
- printf("%d\n", (unsigned)a >= a);
- printf("%d\n", (unsigned)b > a);
-}
-
-struct empty {
-};
-
-struct aligntest1 {
- char a[10];
-};
-
-struct aligntest2 {
- int a;
- char b[10];
-};
-
-struct aligntest3 {
- double a, b;
-};
-
-struct aligntest4 {
- double a[0];
-};
-
-void struct_test()
-{
- struct1 *s;
- union union2 u;
-
- printf("struct:\n");
- printf("sizes: %d %d %d %d\n",
- sizeof(struct struct1),
- sizeof(struct struct2),
- sizeof(union union1),
- sizeof(union union2));
- st1.f1 = 1;
- st1.f2 = 2;
- st1.f3 = 3;
- printf("st1: %d %d %d\n",
- st1.f1, st1.f2, st1.f3);
- st1.u.v1 = 1;
- st1.u.v2 = 2;
- printf("union1: %d\n", st1.u.v1);
- u.w1 = 1;
- u.w2 = 2;
- printf("union2: %d\n", u.w1);
- s = &st2;
- s->f1 = 3;
- s->f2 = 2;
- s->f3 = 1;
- printf("st2: %d %d %d\n",
- s->f1, s->f2, s->f3);
- printf("str_addr=%x\n", (int)st1.str - (int)&st1.f1);
-
- /* align / size tests */
- printf("aligntest1 sizeof=%d alignof=%d\n",
- sizeof(struct aligntest1), __alignof__(struct aligntest1));
- printf("aligntest2 sizeof=%d alignof=%d\n",
- sizeof(struct aligntest2), __alignof__(struct aligntest2));
- printf("aligntest3 sizeof=%d alignof=%d\n",
- sizeof(struct aligntest3), __alignof__(struct aligntest3));
- printf("aligntest4 sizeof=%d alignof=%d\n",
- sizeof(struct aligntest4), __alignof__(struct aligntest4));
-
- /* empty structures (GCC extension) */
- printf("sizeof(struct empty) = %d\n", sizeof(struct empty));
- printf("alignof(struct empty) = %d\n", __alignof__(struct empty));
-}
-
-/* XXX: depend on endianness */
-void char_short_test()
-{
- int var1, var2;
-
- printf("char_short:\n");
-
- var1 = 0x01020304;
- var2 = 0xfffefdfc;
- printf("s8=%d %d\n",
- *(char *)&var1, *(char *)&var2);
- printf("u8=%d %d\n",
- *(unsigned char *)&var1, *(unsigned char *)&var2);
- printf("s16=%d %d\n",
- *(short *)&var1, *(short *)&var2);
- printf("u16=%d %d\n",
- *(unsigned short *)&var1, *(unsigned short *)&var2);
- printf("s32=%d %d\n",
- *(int *)&var1, *(int *)&var2);
- printf("u32=%d %d\n",
- *(unsigned int *)&var1, *(unsigned int *)&var2);
- *(char *)&var1 = 0x08;
- printf("var1=%x\n", var1);
- *(short *)&var1 = 0x0809;
- printf("var1=%x\n", var1);
- *(int *)&var1 = 0x08090a0b;
- printf("var1=%x\n", var1);
-}
-
-/******************/
-
-typedef struct Sym {
- int v;
- int t;
- int c;
- struct Sym *next;
- struct Sym *prev;
-} Sym;
-
-#define ISLOWER(c) ('a' <= (c) && (c) <= 'z')
-#define TOUPPER(c) (ISLOWER(c) ? 'A' + ((c) - 'a') : (c))
-
-static int toupper1(int a)
-{
- return TOUPPER(a);
-}
-
-void bool_test()
-{
- int *s, a, b, t, f, i;
-
- a = 0;
- s = (void*)0;
- printf("!s=%d\n", !s);
-
- if (!s || !s[0])
- a = 1;
- printf("a=%d\n", a);
-
- printf("a=%d %d %d\n", 0 || 0, 0 || 1, 1 || 1);
- printf("a=%d %d %d\n", 0 && 0, 0 && 1, 1 && 1);
- printf("a=%d %d\n", 1 ? 1 : 0, 0 ? 1 : 0);
-#if 1 && 1
- printf("a1\n");
-#endif
-#if 1 || 0
- printf("a2\n");
-#endif
-#if 1 ? 0 : 1
- printf("a3\n");
-#endif
-#if 0 ? 0 : 1
- printf("a4\n");
-#endif
-
- a = 4;
- printf("b=%d\n", a + (0 ? 1 : a / 2));
-
- /* test register spilling */
- a = 10;
- b = 10;
- a = (a + b) * ((a < b) ?
- ((b - a) * (a - b)): a + b);
- printf("a=%d\n", a);
-
- /* test complex || or && expressions */
- t = 1;
- f = 0;
- a = 32;
- printf("exp=%d\n", f == (32 <= a && a <= 3));
- printf("r=%d\n", (t || f) + (t && f));
-
- /* test ? : cast */
- {
- int aspect_on;
- int aspect_native = 65536;
- double bfu_aspect = 1.0;
- int aspect;
- for(aspect_on = 0; aspect_on < 2; aspect_on++) {
- aspect=aspect_on?(aspect_native*bfu_aspect+0.5):65535UL;
- printf("aspect=%d\n", aspect);
- }
- }
-
- /* Test passing structs & function pointers though conditional
- * operator ? :. This is bug grischka-20050929 case_1 */
- {
- struct test1 { int a, b, c; };
- struct test1 t0 = {10,20,30};
- struct test1 t1 = {11,21,31};
- struct test1 tx = {0,0,0};
- int (*pfn)(int);
- int f = 0;
-
- tx = f==0 ? t0 : t1;
- printf("case_1.1: 10,20,30 -> %d,%d,%d\n", tx.a, tx.b, tx.c);
-
- /* This tests to see that function pointers correctly pass through
- the conditional operator ?:. This tests for
- grischka-20050929 case_1.2. Note that this was already FIXED
- in rl-1.0.0, but we want to TEST for it too. */
- pfn = f ? some_fn : other_fn;
- printf("case_1.2: other -> %s\n", 1==pfn(1)?"some":"other");
- }
-
-
- /* test ? : GCC extension */
- {
- static int v1 = 34 ? : -1; /* constant case */
- static int v2 = 0 ? : -1; /* constant case */
- int a = 30;
-
- printf("%d %d\n", v1, v2);
- printf("%d %d\n", a - 30 ? : a * 2, a + 1 ? : a * 2);
- }
-
- /* again complex expression */
- for(i=0;i<256;i++) {
- if (toupper1 (i) != TOUPPER (i))
- printf("error %d\n", i);
- }
-
-}
-
-/* GCC accepts that */
-static int tab_reinit[];
-static int tab_reinit[10];
-
-//int cinit1; /* a global variable can be defined several times without error ! */
-int cinit1;
-int cinit1;
-int cinit1 = 0;
-int *cinit2 = (int []){3, 2, 1};
-
-void compound_literal_test(void)
-{
- int *p, i;
- char *q, *q3;
-
- printf("compound_test:\n");
-
- p = (int []){1, 2, 3};
- for(i=0;i<3;i++)
- printf(" %d", p[i]);
- printf("\n");
-
- for(i=0;i<3;i++)
- printf("%d", cinit2[i]);
- printf("\n");
-
- q = "tralala1";
- printf("q1=%s\n", q);
-
- q = (char *){ "tralala2" };
- printf("q2=%s\n", q);
-
- q3 = (char *){ q };
- printf("q3=%s\n", q3);
-
- q = (char []){ "tralala3" };
- printf("q4=%s\n", q);
-
-#ifdef ALL_ISOC99
- p = (int []){1, 2, cinit1 + 3};
- for(i=0;i<3;i++)
- printf(" %d", p[i]);
- printf("\n");
-
- for(i=0;i<3;i++) {
- p = (int []){1, 2, 4 + i};
- printf("%d %d %d\n",
- p[0],
- p[1],
- p[2]);
- }
-#endif
-}
-
-/* K & R protos */
-
-kr_func1(a, b)
-{
- return a + b;
-}
-
-int kr_func2(a, b)
-{
- return a + b;
-}
-
-kr_test()
-{
- printf("kr_test:\n");
- printf("func1=%d\n", kr_func1(3, 4));
- printf("func2=%d\n", kr_func2(3, 4));
- return 0;
-}
-
-void num(int n)
-{
- char *tab, *p;
- tab = (char*)malloc(20);
- p = tab;
- while (1) {
- *p = 48 + (n % 10);
- p++;
- n = n / 10;
- if (n == 0)
- break;
- }
- while (p != tab) {
- p--;
- printf("%c", *p);
- }
- printf("\n");
-}
-
-/* structure assignment tests */
-struct structa1 {
- int f1;
- char f2;
-};
-
-struct structa1 ssta1;
-
-void struct_assign_test1(struct structa1 s1, int t)
-{
- printf("%d %d %d\n", s1.f1, s1.f2, t);
-}
-
-struct structa1 struct_assign_test2(struct structa1 s1, int t)
-{
- s1.f1 += t;
- s1.f2 -= t;
- return s1;
-}
-
-void struct_assign_test3(void)
-{
- // incompatible assigment
- struct _s1 { int a, b, c; } *p1 = NULL;
- struct _s2 { int a, b, c; } *p2 = p1; //warning
- printf("struct assign, 0 -> %x\n", p2);
-}
-
-void struct_assign_test(void)
-{
- struct structa1 lsta1, lsta2;
-
-#if 0
- printf("struct_assign_test:\n");
-
- lsta1.f1 = 1;
- lsta1.f2 = 2;
- printf("%d %d\n", lsta1.f1, lsta1.f2);
- lsta2 = lsta1;
- printf("%d %d\n", lsta2.f1, lsta2.f2);
-#else
- lsta2.f1 = 1;
- lsta2.f2 = 2;
-#endif
- struct_assign_test1(lsta2, 3);
-
- printf("before call: %d %d\n", lsta2.f1, lsta2.f2);
- lsta2 = struct_assign_test2(lsta2, 4);
- printf("after call: %d %d\n", lsta2.f1, lsta2.f2);
- struct_assign_test3();
-}
-
-/* casts to short/char */
-
-void cast1(char a, short b, unsigned char c, unsigned short d)
-{
- printf("%d %d %d %d\n", a, b, c, d);
-}
-
-char bcast;
-short scast;
-
-void cast_test()
-{
- int a;
- char c;
- char tab[10];
- unsigned b,d;
- short s;
- double g = 0.1;
-
- printf("cast_test:\n");
- a = 0xfffff;
- cast1(a, a, a, a);
- a = 0xffffe;
- printf("%d %d %d %d\n",
- (char)(a + 1),
- (short)(a + 1),
- (unsigned char)(a + 1),
- (unsigned short)(a + 1));
- printf("%d %d %d %d\n",
- (char)0xfffff,
- (short)0xfffff,
- (unsigned char)0xfffff,
- (unsigned short)0xfffff);
-
- a = (bcast = 128) + 1;
- printf("%d\n", a);
- a = (scast = 65536) + 1;
- printf("%d\n", a);
-
- printf("sizeof(c) = %d, sizeof((int)c) = %d\n", sizeof(c), sizeof((int)c));
-
- /* test cast from unsigned to signed short to int */
- b = 0xf000;
- d = (short)b;
- printf("((unsigned)(short)0x%08x) = 0x%08x\n", b, d);
- b = 0xf0f0;
- d = (char)b;
- printf("((unsigned)(char)0x%08x) = 0x%08x\n", b, d);
-
- /* Try casting pointer to short or _Bool (grishka case_6.1). This
- * is lossy, so tcc will print a warning. This capability is needed
- * to compile gcc 2.95 as well as other programs. */
- {
- void *p = (void *) 3;
- printf("Expect 3 1 -> %hd %hhd\n",
- (short) p, (_Bool) p); /* Expect warning */
- }
-
-
- /* test implicit int casting for array accesses */
- c = 0;
- tab[1] = 2;
- tab[c] = 1;
- printf("%d %d\n", tab[0], tab[1]);
-
- /* test implicit casting on some operators */
- printf("sizeof(+(char)'a') = %d\n", sizeof(+(char)'a'));
- printf("sizeof(-(char)'a') = %d\n", sizeof(-(char)'a'));
- printf("sizeof(~(char)'a') = %d\n", sizeof(-(char)'a'));
-
- /* Cast float to bool */
- printf("%d\n", (_Bool) 0.1);
- /* Cast non-constant double 0.1 to bool, should be 1, grischka case 6.2 */
- printf("1 -> %d\n", (_Bool) g);
-
- /* Cast with sign extension */
- a = (short)0xf000;
- printf("0x%x == 0xfffff000\n", a);
- a = (signed char)0xf0f0;
- printf("0x%x == 0xfffffff0\n", a);
-}
-
-/* initializers tests */
-struct structinit1 {
- int f1;
- char f2;
- short f3;
- int farray[3];
-};
-
-int sinit1 = 2;
-int sinit2 = { 3 };
-int sinit3[3] = { 1, 2, {{3}}, };
-int sinit4[3][2] = { {1, 2}, {3, 4}, {5, 6} };
-int sinit5[3][2] = { 1, 2, 3, 4, 5, 6 };
-int sinit6[] = { 1, 2, 3 };
-int sinit7[] = { [2] = 3, [0] = 1, 2 };
-char sinit8[] = "hello" "trala";
-
-struct structinit1 sinit9 = { 1, 2, 3 };
-struct structinit1 sinit10 = { .f2 = 2, 3, .f1 = 1 };
-struct structinit1 sinit11 = { .f2 = 2, 3, .f1 = 1,
-#ifdef ALL_ISOC99
- .farray[0] = 10,
- .farray[1] = 11,
- .farray[2] = 12,
-#endif
-};
-
-char *sinit12 = "hello world";
-char *sinit13[] = {
- "test1",
- "test2",
- "test3",
-};
-char sinit14[10] = { "abc" };
-int sinit15[3] = { sizeof(sinit15), 1, 2 };
-
-struct { int a[3], b; } sinit16[] = { { 1 }, 2 };
-
-struct bar {
- char *s;
- int len;
-} sinit17[] = {
- "a1", 4,
- "a2", 1
-};
-
-int sinit18[10] = {
- [2 ... 5] = 20,
- 2,
- [8] = 10,
-};
-
-void init_test(void)
-{
- int linit1 = 2;
- int linit2 = { 3 };
- int linit4[3][2] = { {1, 2}, {3, 4}, {5, 6} };
- int linit6[] = { 1, 2, 3 };
- int i, j;
- char linit8[] = "hello" "trala";
- int linit12[10] = { 1, 2 };
- int linit13[10] = { 1, 2, [7] = 3, [3] = 4, };
- char linit14[10] = "abc";
- int linit15[10] = { linit1, linit1 + 1, [6] = linit1 + 2, };
- struct linit16 { int a1, a2, a3, a4; } linit16 = { 1, .a3 = 2 };
- int linit17 = sizeof(linit17);
-
- printf("init_test:\n");
-
- printf("sinit1=%d\n", sinit1);
- printf("sinit2=%d\n", sinit2);
- printf("sinit3=%d %d %d %d\n",
- sizeof(sinit3),
- sinit3[0],
- sinit3[1],
- sinit3[2]
- );
- printf("sinit6=%d\n", sizeof(sinit6));
- printf("sinit7=%d %d %d %d\n",
- sizeof(sinit7),
- sinit7[0],
- sinit7[1],
- sinit7[2]
- );
- printf("sinit8=%s\n", sinit8);
- printf("sinit9=%d %d %d\n",
- sinit9.f1,
- sinit9.f2,
- sinit9.f3
- );
- printf("sinit10=%d %d %d\n",
- sinit10.f1,
- sinit10.f2,
- sinit10.f3
- );
- printf("sinit11=%d %d %d %d %d %d\n",
- sinit11.f1,
- sinit11.f2,
- sinit11.f3,
- sinit11.farray[0],
- sinit11.farray[1],
- sinit11.farray[2]
- );
-
- for(i=0;i<3;i++)
- for(j=0;j<2;j++)
- printf("[%d][%d] = %d %d %d\n",
- i, j, sinit4[i][j], sinit5[i][j], linit4[i][j]);
- printf("linit1=%d\n", linit1);
- printf("linit2=%d\n", linit2);
- printf("linit6=%d\n", sizeof(linit6));
- printf("linit8=%d %s\n", sizeof(linit8), linit8);
-
- printf("sinit12=%s\n", sinit12);
- printf("sinit13=%d %s %s %s\n",
- sizeof(sinit13),
- sinit13[0],
- sinit13[1],
- sinit13[2]);
- printf("sinit14=%s\n", sinit14);
-
- for(i=0;i<10;i++) printf(" %d", linit12[i]);
- printf("\n");
- for(i=0;i<10;i++) printf(" %d", linit13[i]);
- printf("\n");
- for(i=0;i<10;i++) printf(" %d", linit14[i]);
- printf("\n");
- for(i=0;i<10;i++) printf(" %d", linit15[i]);
- printf("\n");
- printf("%d %d %d %d\n",
- linit16.a1,
- linit16.a2,
- linit16.a3,
- linit16.a4);
- /* test that initialisation is done after variable declare */
- printf("linit17=%d\n", linit17);
- printf("sinit15=%d\n", sinit15[0]);
- printf("sinit16=%d %d\n", sinit16[0].a[0], sinit16[1].a[0]);
- printf("sinit17=%s %d %s %d\n",
- sinit17[0].s, sinit17[0].len,
- sinit17[1].s, sinit17[1].len);
- for(i=0;i<10;i++)
- printf("%x ", sinit18[i]);
- printf("\n");
-}
-
-
-void switch_test()
-{
- int i;
-
- for(i=0;i<15;i++) {
- switch(i) {
- case 0:
- case 1:
- printf("a");
- break;
- default:
- printf("%d", i);
- break;
- case 8 ... 12:
- printf("c");
- break;
- case 3:
- printf("b");
- break;
- }
- }
- printf("\n");
-}
-
-/* ISOC99 _Bool type */
-void c99_bool_test(void)
-{
-#ifdef BOOL_ISOC99
- int a;
- _Bool b;
-
- printf("bool_test:\n");
- printf("sizeof(_Bool) = %d\n", sizeof(_Bool));
- a = 3;
- printf("cast: %d %d %d\n", (_Bool)10, (_Bool)0, (_Bool)a);
- b = 3;
- printf("b = %d\n", b);
- b++;
- printf("b = %d\n", b);
-#endif
-}
-
-void bitfield_test(void)
-{
- int a;
- struct sbf1 {
- int f1 : 3;
- int : 2;
- int f2 : 1;
- int : 0;
- int f3 : 5;
- int f4 : 7;
- unsigned int f5 : 7;
- } st1;
- printf("bitfield_test:");
- printf("sizeof(st1) = %d\n", sizeof(st1));
-
- st1.f1 = 3;
- st1.f2 = 1;
- st1.f3 = 15;
- a = 120;
- st1.f4 = a;
- st1.f5 = a;
- st1.f5++;
- printf("%d %d %d %d %d\n",
- st1.f1, st1.f2, st1.f3, st1.f4, st1.f5);
-
- st1.f1 = 7;
- if (st1.f1 == -1)
- printf("st1.f1 == -1\n");
- else
- printf("st1.f1 != -1\n");
- if (st1.f2 == -1)
- printf("st1.f2 == -1\n");
- else
- printf("st1.f2 != -1\n");
-
- /* Do bitfield assignments return correct rvalue? This is bug
- * grischka-2005-09-29 case_3 */
- {
- struct test1 { unsigned a:1, b:1, c:1, d:1; };
- struct test1 t1 = {0, 1, 0, 1};
- struct test1 *p = &t1;
-
- printf("case_3.1: 0101 -> %d%d%d%d\n", p->a, p->b, p->c, p->d);
- p->b = p->d = 0;
- p->a = p->c = 1;
- printf("case_3.2: 1010 -> %d%d%d%d\n", p->a, p->b, p->c, p->d);
- }
-
-}
-
-#define FTEST(prefix, type, fmt)\
-void prefix ## cmp(type a, type b)\
-{\
- printf("%d %d %d %d %d %d\n",\
- a == b,\
- a != b,\
- a < b,\
- a > b,\
- a >= b,\
- a <= b);\
- printf(fmt " " fmt " " fmt " " fmt " " fmt " " fmt " " fmt "\n",\
- a,\
- b,\
- a + b,\
- a - b,\
- a * b,\
- a / b,\
- -a);\
- printf(fmt "\n", ++a);\
- printf(fmt "\n", a++);\
- printf(fmt "\n", a);\
-}\
-void prefix ## fcast(type a)\
-{\
- float fa;\
- double da;\
- long double la;\
- int ia;\
- unsigned int ua;\
- type b;\
- fa = a;\
- da = a;\
- la = a;\
- printf("ftof: %f %f %Lf\n", fa, da, la);\
- ia = (int)a;\
- ua = (unsigned int)a;\
- printf("ftoi: %d %u\n", ia, ua);\
- ia = -1234;\
- ua = 0x81234500;\
- b = ia;\
- printf("itof: " fmt "\n", b);\
- b = ua;\
- printf("utof: " fmt "\n", b);\
-}\
-\
-void prefix ## test(void)\
-{\
- printf("testing '%s'\n", #type);\
- prefix ## cmp(1, 2.5);\
- prefix ## cmp(2, 1.5);\
- prefix ## cmp(1, 1);\
- prefix ## fcast(234.6);\
- prefix ## fcast(-2334.6);\
-}
-
-FTEST(f, float, "%f")
-FTEST(d, double, "%f")
-FTEST(ld, long double, "%Lf")
-
-double ftab1[3] = { 1.2, 3.4, -5.6 };
-
-
-void float_test(void)
-{
- float fa, fb;
- double da, db;
- int a;
- unsigned int b;
-
- printf("float_test:\n");
- printf("sizeof(float) = %d\n", sizeof(float));
- printf("sizeof(double) = %d\n", sizeof(double));
- printf("sizeof(long double) = %d\n", sizeof(long double));
- ftest();
- dtest();
- ldtest();
- printf("%f %f %f\n", ftab1[0], ftab1[1], ftab1[2]);
- printf("%f %f %f\n", 2.12, .5, 2.3e10);
- // printf("%f %f %f\n", 0x1234p12, 0x1e23.23p10, 0x12dp-10);
- da = 123;
- printf("da=%f\n", da);
- fa = 123;
- printf("fa=%f\n", fa);
- a = 4000000000;
- da = a;
- printf("da = %f\n", da);
- b = 4000000000;
- db = b;
- printf("db = %f\n", db);
-}
-
-int fib(int n)
-{
- if (n <= 2)
- return 1;
- else
- return fib(n-1) + fib(n-2);
-}
-
-int reply_self(int x)
-{
- return x;
-}
-
-void funcptr_test()
-{
- void (*func)(int);
- int a;
- struct {
- int dummy;
- void (*func)(int);
- } st1;
-
- printf("funcptr:\n");
- func = #
- (*func)(12345);
- func = num;
- a = 1;
- a = 1;
- func(12345);
- /* more complicated pointer computation */
- st1.func = num;
- st1.func(12346);
- printf("sizeof1 = %d\n", sizeof(funcptr_test));
- printf("sizeof2 = %d\n", sizeof funcptr_test);
- printf("sizeof3 = %d\n", sizeof(&funcptr_test));
- printf("sizeof4 = %d\n", sizeof &funcptr_test);
-
- /* Test function pointer indirection */
- {
- int (*pfn)(int) = reply_self;
- printf("case_9: 1 (7,8) -> %d (%d,%d)\n",
- (int) (reply_self == *pfn), pfn(7), (******pfn)(8));
- }
-
-}
-
-void lloptest(long long a, long long b)
-{
- unsigned long long ua, ub;
-
- ua = a;
- ub = b;
- /* arith */
- printf("arith: %Ld %Ld %Ld\n",
- a + b,
- a - b,
- a * b);
-
- if (b != 0) {
- printf("arith1: %Ld %Ld\n",
- a / b,
- a % b);
- }
-
- /* binary */
- printf("bin: %Ld %Ld %Ld\n",
- a & b,
- a | b,
- a ^ b);
-
- /* tests */
- printf("test: %d %d %d %d %d %d\n",
- a == b,
- a != b,
- a < b,
- a > b,
- a >= b,
- a <= b);
-
- printf("utest: %d %d %d %d %d %d\n",
- ua == ub,
- ua != ub,
- ua < ub,
- ua > ub,
- ua >= ub,
- ua <= ub);
-
- /* arith2 */
- a++;
- b++;
- printf("arith2: %Ld %Ld\n", a, b);
- printf("arith2: %Ld %Ld\n", a++, b++);
- printf("arith2: %Ld %Ld\n", --a, --b);
- printf("arith2: %Ld %Ld\n", a, b);
-}
-
-void llshift(long long a, int b)
-{
- printf("shift: %Ld %Ld %Ld\n",
- (unsigned long long)a >> b,
- a >> b,
- a << b);
- printf("shiftc: %Ld %Ld %Ld\n",
- (unsigned long long)a >> 3,
- a >> 3,
- a << 3);
- printf("shiftc: %Ld %Ld %Ld\n",
- (unsigned long long)a >> 35,
- a >> 35,
- a << 35);
-}
-
-void llfloat(void)
-{
- float fa;
- double da;
- long double lda;
- long long la, lb, lc;
- unsigned long long ula, ulb, ulc;
- la = 0x12345678;
- ula = 0x72345678;
- la = (la << 20) | 0x12345;
- ula = ula << 33;
- printf("la=%Ld ula=%Lu\n", la, ula);
-
- fa = la;
- da = la;
- lda = la;
- printf("lltof: %f %f %Lf\n", fa, da, lda);
-
- la = fa;
- lb = da;
- lc = lda;
- printf("ftoll: %Ld %Ld %Ld\n", la, lb, lc);
-
- fa = ula;
- da = ula;
- lda = ula;
- printf("ulltof: %f %f %Lf\n", fa, da, lda);
-
- ula = fa;
- ulb = da;
- ulc = lda;
- printf("ftoull: %Lu %Lu %Lu\n", ula, ulb, ulc);
-}
-
-long long llfunc1(int a)
-{
- return a * 2;
-}
-
-struct S {
- int id;
- char item;
-};
-
-long long int value(struct S *v)
-{
- return ((long long int)v->item);
-}
-
-void longlong_test(void)
-{
- long long a, b, c;
- unsigned long long ull;
- int ia;
- unsigned int ua;
- printf("longlong_test:\n");
- printf("sizeof(long long) = %d\n", sizeof(long long));
- ia = -1;
- ua = -2;
- a = ia;
- b = ua;
- printf("%Ld %Ld\n", a, b);
- printf("%Ld %Ld %Ld %Lx\n",
- (long long)1,
- (long long)-2,
- 1LL,
- 0x1234567812345679);
- a = llfunc1(-3);
- printf("%Ld\n", a);
-
- lloptest(1000, 23);
- lloptest(0xff, 0x1234);
- b = 0x72345678 << 10;
- lloptest(-3, b);
- llshift(0x123, 5);
- llshift(-23, 5);
- b = 0x72345678LL << 10;
- llshift(b, 47);
-
- llfloat();
-#if 1
- b = 0x12345678;
- a = -1;
- c = a + b;
- printf("%Lx\n", c);
-#endif
-
- /* long long reg spill test */
- {
- struct S a;
-
- a.item = 3;
- printf("%lld\n", value(&a));
- }
- lloptest(0x80000000, 0);
-
- /* another long long spill test */
- {
- long long *p, v;
- v = 1;
- p = &v;
- p[0]++;
- printf("%lld\n", *p);
- }
-
- /* Make sure long long comparison tests upper 32 bits */
- ull = 0xffffffff00000000ULL;
- printf("ull=%llx\n",ull);
- printf("ull!=0 ", (ull != 0) ? "true" : "false");
- printf("ull ", ull ? "true" : "false");
-
- /* check double -> ull cast */
- {
- double d = 2.4e18;
- unsigned long long ull = d;
- unsigned long long r = 100000000000LL;
- printf("\ndouble->ull (grischka case 10): %.0f -> %ld\n",
- d/r, (long)(ull/r));
- }
-
-}
-
-void vprintf1(const char *fmt, ...)
-{
- va_list ap;
- const char *p;
- int c, i;
- double d;
- long long ll;
-
- va_start(ap, fmt);
-
- p = fmt;
- for(;;) {
- c = *p;
- if (c == '\0')
- break;
- p++;
- if (c == '%') {
- c = *p;
- switch(c) {
- case '\0':
- goto the_end;
- case 'd':
- i = va_arg(ap, int);
- printf("%d", i);
- break;
- case 'f':
- d = va_arg(ap, double);
- printf("%f", d);
- break;
- case 'l':
- ll = va_arg(ap, long long);
- printf("%Ld", ll);
- break;
- }
- p++;
- } else {
- putchar(c);
- }
- }
- the_end:
- va_end(ap);
-}
-
-
-void stdarg_test(void)
-{
- vprintf1("%d %d %d\n", 1, 2, 3);
- vprintf1("%f %d %f\n", 1.0, 2, 3.0);
- vprintf1("%l %l %d %f\n", 1234567891234LL, 987654321986LL, 3, 1234.0);
-}
-
-void whitespace_test(void)
-{
- char *str;
-
-#if 1
- printf("whitspace:\n");
-#endif
- pf("N=%d\n", 2);
-
-#ifdef CORRECT_CR_HANDLING
- printf("aaa=%d\n", 3);
-#endif
-
- pri\
-\
-ntf("min=%d\n", 4);
-
-#ifdef ACCEPT_CR_IN_STRINGS
- printf("len1=%d\n", strlen("
-"));
-#ifdef CORRECT_CR_HANDLING
- str = "
-";
- printf("len1=%d str[0]=%d\n", strlen(str), str[0]);
-#endif
- printf("len1=%d\n", strlen("\ra
-"));
-#endif /* ACCEPT_CR_IN_STRINGS */
-}
-
-int reltab[3] = { 1, 2, 3 };
-
-int *rel1 = &reltab[1];
-int *rel2 = &reltab[2];
-
-void relocation_test(void)
-{
- printf("*rel1=%d\n", *rel1);
- printf("*rel2=%d\n", *rel2);
-}
-
-void old_style_f(a,b,c)
- int a, b;
- double c;
-{
- printf("a=%d b=%d b=%f\n", a, b, c);
-}
-
-void decl_func1(int cmpfn())
-{
- printf("cmpfn=%lx\n", (long)cmpfn);
-}
-
-void decl_func2(cmpfn)
-int cmpfn();
-{
- printf("cmpfn=%lx\n", (long)cmpfn);
-}
-
-void old_style_function(void)
-{
- old_style_f((void *)1, 2, 3.0);
- decl_func1(NULL);
- decl_func2(NULL);
-}
-
-void sizeof_test(void)
-{
- int a;
- int **ptr;
-
- printf("sizeof(int) = %d\n", sizeof(int));
- printf("sizeof(unsigned int) = %d\n", sizeof(unsigned int));
- printf("sizeof(short) = %d\n", sizeof(short));
- printf("sizeof(unsigned short) = %d\n", sizeof(unsigned short));
- printf("sizeof(char) = %d\n", sizeof(char));
- printf("sizeof(unsigned char) = %d\n", sizeof(unsigned char));
- printf("sizeof(func) = %d\n", sizeof sizeof_test());
- a = 1;
- printf("sizeof(a++) = %d\n", sizeof a++);
- printf("a=%d\n", a);
- ptr = NULL;
- printf("sizeof(**ptr) = %d\n", sizeof (**ptr));
- printf("-1>sizeof(int) = %d\n", -1>sizeof(int));
-
- /* some alignof tests */
- printf("__alignof__(int) = %d\n", __alignof__(int));
- printf("__alignof__(unsigned int) = %d\n", __alignof__(unsigned int));
- printf("__alignof__(short) = %d\n", __alignof__(short));
- printf("__alignof__(unsigned short) = %d\n", __alignof__(unsigned short));
- printf("__alignof__(char) = %d\n", __alignof__(char));
- printf("__alignof__(unsigned char) = %d\n", __alignof__(unsigned char));
- printf("__alignof__(func) = %d\n", __alignof__ sizeof_test());
-}
-
-void typeof_test(void)
-{
- double a;
- typeof(a) b;
- typeof(float) c;
-
- a = 1.5;
- b = 2.5;
- c = 3.5;
- printf("a=%f b=%f c=%f\n", a, b, c);
-}
-
-void statement_expr_test(void)
-{
- int a, i;
-
- a = 0;
- for(i=0;i<10;i++) {
- a += 1 +
- ( { int b, j;
- b = 0;
- for(j=0;j<5;j++)
- b += j; b;
- } );
- }
- printf("a=%d\n", a);
-
-}
-
-void local_label_test(void)
-{
- int a;
- goto l1;
- l2:
- a = 1 + ({
- __label__ l1, l2, l3, l4;
- goto l1;
- l4:
- printf("aa1\n");
- goto l3;
- l2:
- printf("aa3\n");
- goto l4;
- l1:
- printf("aa2\n");
- goto l2;
- l3:;
- 1;
- });
- printf("a=%d\n", a);
- return;
- l4:
- printf("bb1\n");
- goto l2;
- l1:
- printf("bb2\n");
- goto l4;
-}
-
-/* inline assembler test */
-#ifdef __i386__
-
-/* from linux kernel */
-static char * strncat1(char * dest,const char * src,size_t count)
-{
-int d0, d1, d2, d3;
-__asm__ __volatile__(
- "repne\n\t"
- "scasb\n\t"
- "decl %1\n\t"
- "movl %8,%3\n"
- "1:\tdecl %3\n\t"
- "js 2f\n\t"
- "lodsb\n\t"
- "stosb\n\t"
- "testb %%al,%%al\n\t"
- "jne 1b\n"
- "2:\txorl %2,%2\n\t"
- "stosb"
- : "=&S" (d0), "=&D" (d1), "=&a" (d2), "=&c" (d3)
- : "0" (src),"1" (dest),"2" (0),"3" (0xffffffff), "g" (count)
- : "memory");
-return dest;
-}
-
-static inline void * memcpy1(void * to, const void * from, size_t n)
-{
-int d0, d1, d2;
-__asm__ __volatile__(
- "rep ; movsl\n\t"
- "testb $2,%b4\n\t"
- "je 1f\n\t"
- "movsw\n"
- "1:\ttestb $1,%b4\n\t"
- "je 2f\n\t"
- "movsb\n"
- "2:"
- : "=&c" (d0), "=&D" (d1), "=&S" (d2)
- :"0" (n/4), "q" (n),"1" ((long) to),"2" ((long) from)
- : "memory");
-return (to);
-}
-
-static __inline__ void sigaddset1(unsigned int *set, int _sig)
-{
- __asm__("btsl %1,%0" : "=m"(*set) : "Ir"(_sig - 1) : "cc");
-}
-
-static __inline__ void sigdelset1(unsigned int *set, int _sig)
-{
- asm("btrl %1,%0" : "=m"(*set) : "Ir"(_sig - 1) : "cc");
-}
-
-static __inline__ __const__ unsigned int swab32(unsigned int x)
-{
- __asm__("xchgb %b0,%h0\n\t" /* swap lower bytes */
- "rorl $16,%0\n\t" /* swap words */
- "xchgb %b0,%h0" /* swap higher bytes */
- :"=q" (x)
- : "0" (x));
- return x;
-}
-
-static __inline__ unsigned long long mul64(unsigned int a, unsigned int b)
-{
- unsigned long long res;
- __asm__("mull %2" : "=A" (res) : "a" (a), "r" (b));
- return res;
-}
-
-static __inline__ unsigned long long inc64(unsigned long long a)
-{
- unsigned long long res;
- __asm__("addl $1, %%eax ; adcl $0, %%edx" : "=A" (res) : "A" (a));
- return res;
-}
-
-unsigned int set;
-
-void asm_test(void)
-{
- char buf[128];
- unsigned int val;
-
- printf("inline asm:\n");
- /* test the no operand case */
- asm volatile ("xorl %eax, %eax");
-
- memcpy1(buf, "hello", 6);
- strncat1(buf, " worldXXXXX", 3);
- printf("%s\n", buf);
-
- /* 'A' constraint test */
- printf("mul64=0x%Lx\n", mul64(0x12345678, 0xabcd1234));
- printf("inc64=0x%Lx\n", inc64(0x12345678ffffffff));
-
- set = 0xff;
- sigdelset1(&set, 2);
- sigaddset1(&set, 16);
- /* NOTE: we test here if C labels are correctly restored after the
- asm statement */
- goto label1;
- label2:
- __asm__("btsl %1,%0" : "=m"(set) : "Ir"(20) : "cc");
- printf("set=0x%x\n", set);
- val = 0x01020304;
- printf("swab32(0x%08x) = 0x%0x\n", val, swab32(val));
- return;
- label1:
- goto label2;
-}
-
-#else
-
-void asm_test(void)
-{
-}
-
-#endif
-
-#define COMPAT_TYPE(type1, type2) \
-{\
- printf("__builtin_types_compatible_p(%s, %s) = %d\n", #type1, #type2, \
- __builtin_types_compatible_p (type1, type2));\
-}
-
-int constant_p_var;
-
-void builtin_test(void)
-{
-#if GCC_MAJOR >= 3
- COMPAT_TYPE(int, int);
- COMPAT_TYPE(int, unsigned int);
- COMPAT_TYPE(int, char);
- COMPAT_TYPE(int, const int);
- COMPAT_TYPE(int, volatile int);
- COMPAT_TYPE(int *, int *);
- COMPAT_TYPE(int *, void *);
- COMPAT_TYPE(int *, const int *);
- COMPAT_TYPE(char *, unsigned char *);
-/* space is needed because tcc preprocessor introduces a space between each token */
- COMPAT_TYPE(char * *, void *);
-#endif
- printf("res = %d\n", __builtin_constant_p(1));
- printf("res = %d\n", __builtin_constant_p(1 + 2));
- printf("res = %d\n", __builtin_constant_p(&constant_p_var));
- printf("res = %d\n", __builtin_constant_p(constant_p_var));
-}
-
-
-/* static_stub1 takes a pointer to a function, and returns a pointer to
- * a function; that function must accept no parameters, and return nothing. */
-void ((*static_stub1(void ((*p)(void)))) (void))
-{
- static void (*pfn)(void);
- void (*mytemp)(void);
- mytemp = pfn;
- pfn = p;
- return mytemp;
-}
-
-/* Another stub. The static "pfn" is in a different function, so it'd better
- not be mapped to the same memory location. */
-void ((*static_stub2(void ((*p)(void)))) (void))
-{
- static void (*pfn)(void);
- void (*mytemp)(void);
- mytemp = pfn;
- pfn = p;
- return mytemp;
-}
-
-
-void static_test(void)
-{
- void (*result)(void);
- result = static_stub1(static_test);
- printf("static_test Expect 1 -> %d\n", result == 0);
- result = static_stub1(static_test);
- printf("static_test Expect 1 -> %d\n", result == static_test);
- result = static_stub2(static_test);
- printf("static_test Expect 1 -> %d\n", result == 0);
- result = static_stub2(static_test);
- printf("static_test Expect 1 -> %d\n", result == static_test);
-}
-
-
-void const_func(const int a)
-{
-}
-
-void const_warn_test(void)
-{
- const_func(1);
-}
+++ /dev/null
-long long foo(void) {
- return -1;
-}
-
-int main(void) {
- return 1 + foo();
-}
+++ /dev/null
-#ifdef _WIN32
-#define __thread __declspec( thread )
-#endif
-
-__thread int tls_i[10];
-__thread int tls_j = 5;
-
-int test(int i) {
- tls_j = i;
- return tls_i[i];
-}
-
-int main()
-{
- printf("tls_i: %d\n", test(3));
- printf("tls_j: %d\n", tls_j);
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-/*
- * Proj's of the arguments
- * Simple DF node.
- */
-int add(int a, int b) {
- return a + b;
-}
-
-int main(int argc, char *argv[])
-{
- printf("%d\n", add(1, 2));
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-/*
- * Proj out of DF node
- */
-int do_div(int a, int b) {
- return a / b;
-}
-
-
-int main(int argc, char *argv[])
-{
- printf("%d\n", do_div(1, 2));
- return 0;
-}
+++ /dev/null
-/*
- * first, the empty function
- * shows start and end nodes
- */
-int main(void) {
- return 0;
-}
+++ /dev/null
-/*
- * loads/stores from/to variables
- * Shows the sel node
- */
-#include <stdio.h>
-
-int a;
-int b;
-int c;
-
-void add_a_and_b_to_c(void)
-{
- c = a + b;
-}
-
-int main(int argc, char *argv[])
-{
- a = 1;
- b = 42;
- add_a_and_b_to_c();
- printf("%d\n", c);
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-/*
- * Control flow divertion in an if statement.
- */
-int max(int a, int b) {
- return a > b ? a : b;
-}
-
-int main(int argc, char *argv[])
-{
- printf("%d\n", max(1, 2));
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-/*
- * A simple loop
- * Shows backendges.
- */
-int sum_upto(int n)
-{
- int i, res = 0;
-
- for(i = 0; i < n; ++i)
- res += i;
-
- return res;
-}
-
-int main(int argc, char *argv[])
-{
- printf("%d\n", sum_upto(42));
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-/*
- * Proj's of the arguments
- * Simple DF node.
- */
-int add(int a, int b) {
- return a + b;
-}
-
-/*
- * A function call
- */
-int two_times(int a) {
- return add(a, a);
-}
-
-int main(int argc, char *argv[])
-{
- printf("%d\n", two_times(3));
- return 0;
-}
+++ /dev/null
-int a = 3, b = 4, c = 3;
-
-int truth(int a, int b, int c)
-{
- return (a == c & (a < b));
-}
-
-int main()
-{
- printf("truth(%d, %d, %d) = %d\n", a, b, c, truth(a, b, c));
- return 0;
-}
+++ /dev/null
-struct opcode {
- struct {
- unsigned imm16:16;
- } foo;
-};
-
-
-int main(void) {
- int i;
- struct opcode oc = { { 42 } };
-
- i = oc.foo.imm16 & 0x80f4;
- printf("Result: %d (should be 32)\n", i);
- return 0;
-}
+++ /dev/null
-int main(void) {
- int i = 13957;
- unsigned char c = printf("");
-
- i |= (c ? 0xffffff00 : 0xd3);
- printf("i: %d\n", i);
- return 0;
-}
+++ /dev/null
-int a,b,c,d;
-
-int main(void) {
- b = -a;
- c = !a;
- d = ~a;
- return 0;
-}
+++ /dev/null
-typedef union blub {
- int i;
- char a[4];
-} blub;
-
-blub a = {
- .i = 23,
- .a[2] = 23, 19
-};
-
-blub b = {
- .a[2] = 23, 19,
- .i = 23
-};
-
-#if 0
-blub c = {
- .a[2] = 23, 19, 17,
- .i = 23
-};
-#endif
-
-blub d = {
- .a[2] = 23,
- .i = 23,
- .a[3] = 19
-};
-
-blub e = {
- .a[2] = 23,
- .i = 23,
- .a[2] = 19, 23
-};
-
-blub f = {
- .i = 23,
- .a[2] = 23,
- .a[1] = 19
-};
-
-int main(void)
-{
- printf("%d %d %d %d\n", a.a[0], a.a[1], a.a[2], a.a[3]);
- printf("%d\n", b.i);
- printf("%d %d %d %d\n", d.a[0], d.a[1], d.a[2], d.a[3]);
- printf("%d %d %d %d\n", e.a[0], e.a[1], e.a[2], e.a[3]);
- printf("%d %d %d %d\n", f.a[0], f.a[1], f.a[2], f.a[3]);
- return 0;
-}
+++ /dev/null
-/*$ -fcombo $*/
-
-int main() {
- int x;
-
- if (x == 2)
- printf("x == 2\n");
- if (x == 3)
- printf("x == 3\n");
-
- switch (x) {
- case 1:
- printf("Case 1\n");
- break;
- case 2:
- printf("Case 1\n");
- break;
- }
-
- return 0;
-}
+++ /dev/null
-/*$ -fcombo $*/
-
-/*
- * This is a example for the 'Top reaches if first'
- * problem.
- *
- * If the Cond is evaluated BEFORE the Phi(Unknown, 1)
- * gets the Const 1, we decide for != and cannot revert
- * this decision...
- */
-int main(int argc) {
- int x;
-
- if (argc) {
- x = 1;
- } else {
- ++argc;
- }
-
- if (x == 1) {
- printf("x == 1\n");
- } else {
- printf("x != 1\n");
- }
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-void foo(void) {
- char *f1;
-
- printf("%d\n", *f1);
- return;
-}
-
-int main(void) {
- return 0;
-}
+++ /dev/null
-/************************************************************************
- * Program: vadd_store.c
- * Function: Add 2 vectors (lying in memory) and store the result in
- * a another vector in memory.
- * Used as a test for the simd optimization.
- * Author: Andreas Schoesser
- * Date: 2007-02-13
- ************************************************************************/
-
-#include <stdio.h>
-#include <malloc.h>
-#include <stdlib.h>
-
-#if 0
-void vadd_store(void)
-{
- /*Also possible: Local pointers instead of function parameters: */
- //int *a = (int *) alloca(8), *b = (int *) alloca(8), *c = (int *) alloca(8);
- int a[2], b[2], c[2];
- int i;
-
- printf("1. vload -> vadd -> vstore\n===================\n\n");
-
- for(i = 0; i < 2; i++)
- {
- a[i] = rand() % 10;
- b[i] = rand() % 10;
- }
-
-
-/* Also possible: Local arrays, but may be optimized so that no pattern is found
- int a[2], b[2], c[2]; */
-
-
-/* Version 1: Directly adding. */
-
- c[0] = a[0] + b[0];
- c[1] = a[1] + b[1];
-
-
-
-/* Version 2: Adding of local variables
-
- int a0, a1, b0, b1, c0, c1;
-
- a0 = a[0];
- a1 = a[1];
- b0 = b[0];
- b1 = b[1];
-
- c0 = a0 + b0;
- c1 = a1 + b1;
-
- c[0] = c0;
- c[1] = c1; */
-
-
-
-/* Version 3: Mixed adding of locals and pointers
-
- int a0, b1, c0;
-
- a0 = a[0];
- b1 = b[1];
-
- c0 = a0 + b[0];
- c[1] = a[1] + b1;
-
- c[0] = c0; */
-
- for(i = 0; i < 2; i++)
- printf("%d + %d = %d\n", a[i], b[i], c[i]);
- printf("\n");
-
-}
-#endif
-
-#if 1
-void vadd_loop(void)
-{
- /* Version 4: Manually unrolled loop */
-
- int i, j;
- int d[5][5], e[5][5], f[5][5];
-
- //printf("2. vload -> vadd -> vstore, multi dimensional array, in loop\n==========================================\n\n");
-
- for(j = 0; j < 4; j++)
- for(i = 0; i < 2; i++)
- {
- e[j][i] = rand() % 10;
- f[j][i] = rand() % 10;
- }
-
- for(j = 0; j < 4; j++)
- //for(i = 0; i < 2; i ++ )
- {
- d[j][0] = e[j][0] + f[j][0];
- d[j][1] = e[j][1] + f[j][1];
- }
-
- for(j = 0; j < 4; j++)
- {
- for(i = 0; i < 2; i++)
- printf("%d + %d = %d\n", e[j][i], f[j][i], d[j][i]);
- printf("\n");
- }
-}
-#endif
-
-int main()
-{
- srand(12345);
-
- //vadd_store();
- vadd_loop();
-
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-#if defined(__FIRM_MAJOR__) && defined(__GNUC__)
-#define va_start(v,l) __builtin_va_start(v,l)
-#define va_end(v) __builtin_va_end(v)
-#define va_arg(v,l) __builtin_va_arg(v,l)
-#define va_copy(d,s) __builtin_va_copy(d,s)
-
-typedef __builtin_va_list __gnuc_va_list;
-typedef __gnuc_va_list va_list;
-
-#else
-#include <stdarg.h>
-#endif
-
-char * foo(char *fmt, ...) {
- va_list ap;
- char *s;
-
- va_start(ap, fmt);
- s = va_arg(ap, char *);
- va_end(ap);
- return s;
-}
-
-int main()
-{
- printf("<%s>\n", foo("bla", "blup"));
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-int T6, T10, T13;
-
-/*
- * The VanDrunen example for testimng GVN-PRE.
- * Compile with -f no-const-fold to get the same result ...
- */
-int vandrunen(int t1, int c1, int t11)
-{
- int t12;
- int t9;
- int t8;
- int t7;
- int t5;
- int t4;
- int t3;
- int t2;
-
- t2 = t1;
-
- for (;;) {
- t3 = t2 + 1;
- if (t3 > 50)
- return 0;
-
- if (c1 != 0) {
- t4 = t2 + t3;
- t5 = t4;
- T6 = t1 + t5;
- t8 = t1;
- } else {
- t7 = t3 + 1;
- t8 = t7;
- }
- t9 = t2 + t3;
- T10 = t9 + t8;
- t12 = t9 + t11;
- T13 = t12 + t3;
- t2 = t3;
- }
-}
-
-int main(int argc, char *argv[]) {
- vandrunen(10, argc & 1, 1);
- printf("%d %d %d\n", T6, T10, T13);
- return 0;
-}
+++ /dev/null
-#include <stdio.h>
-
-void print(int *arr, int n) {
- int i;
-
- for(i = 0; i < n; ++i) {
- printf("%d\n", arr[i]);
- }
-}
-
-int test(int data[], int len) {
- int arr[len];
- int i;
-
- for (i = 0; i < len; ++i) {
- arr[i] = data[i];
- }
-
- print(arr, len);
-
- return 0;
-}
-
-int _data[] = {0, 0, 0, 1, 11, 111, 2, 22, 222, 3, 33, 333,
- 4, 44, 444, 5, 55, 555, 6, 66, 666, 7, 77, 777,
- 8, 88, 888, 9, 99, 999};
-static const size_t len = sizeof(_data)/sizeof(_data[0]);
-
-int main()
-{
- test(_data, len);
- return 0;
-}
+++ /dev/null
-/* stabs debug info has problems with VLAs */
-
-#include <stdlib.h>
-
-void f(int x)
-{
- int a[x];
- int i;
- for (i = 0; i < x; ++i) {
- a[i] = rand();
- }
-}
-
-
-int main(void)
-{
- srand(23);
- f(rand() & 31);
- return 0;
-}
+++ /dev/null
-
-volatile int i;
-volatile float f;
-
-int main()
-{
- /* access */
- (void) i;
- (void) f;
-
- /* store */
- i = 5;
- f = 2.4f;
-
- return 0;
-}
+++ /dev/null
-#include<stdio.h>
-
-int main()
-{
- int i = 0;
- int j = 0;
- do
- {
- j++;
- i++;
- printf("%d\n",i);
- }
- while(j < 10);
- printf("Cyklusvariable1: %d\n",j);
-
- i = 0;
- do
- {
- i++;
- }
- while(i < 10);
- printf("Cyklusvariable2: %d\n",i);
-
- return 0;
-};
+++ /dev/null
-#include <stdio.h>
-
-#define MASK 0x00000020
-
-int ctrl_space_write ()
-{
- unsigned int reg_offset = 160;
-
- if ((reg_offset & MASK) == MASK)
- {
- return 1;
- }
-
- return (0);
-}
-
-int main (void)
-{
- int res = ctrl_space_write();
- printf("Result: %d (should be 1)\n", res);
- return res == 1 ? 0 : 1;
-}
projects / libfirm / commitdiff